ID: 1113575406

View in Genome Browser
Species Human (GRCh38)
Location 13:111391743-111391765
Sequence TCGGCAGCTGGACAAAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113575398_1113575406 7 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575406 13:111391743-111391765 TCGGCAGCTGGACAAAGAGAGGG No data
1113575397_1113575406 8 Left 1113575397 13:111391712-111391734 CCCTAGGTGACCAGCAGGGGCTT No data
Right 1113575406 13:111391743-111391765 TCGGCAGCTGGACAAAGAGAGGG No data
1113575402_1113575406 -2 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575406 13:111391743-111391765 TCGGCAGCTGGACAAAGAGAGGG No data
1113575396_1113575406 9 Left 1113575396 13:111391711-111391733 CCCCTAGGTGACCAGCAGGGGCT No data
Right 1113575406 13:111391743-111391765 TCGGCAGCTGGACAAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113575406 Original CRISPR TCGGCAGCTGGACAAAGAGA GGG Intergenic