ID: 1113575413

View in Genome Browser
Species Human (GRCh38)
Location 13:111391769-111391791
Sequence ACGTCTGGGGCAGGGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113575402_1113575413 24 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575413 13:111391769-111391791 ACGTCTGGGGCAGGGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113575413 Original CRISPR ACGTCTGGGGCAGGGTGGAG TGG Intergenic
No off target data available for this crispr