ID: 1113575414

View in Genome Browser
Species Human (GRCh38)
Location 13:111391770-111391792
Sequence CGTCTGGGGCAGGGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113575402_1113575414 25 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575414 13:111391770-111391792 CGTCTGGGGCAGGGTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113575414 Original CRISPR CGTCTGGGGCAGGGTGGAGT GGG Intergenic
No off target data available for this crispr