ID: 1113575592

View in Genome Browser
Species Human (GRCh38)
Location 13:111393173-111393195
Sequence CTGTAGTTCATAAGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113575592_1113575597 9 Left 1113575592 13:111393173-111393195 CCCTCTCTCCTTATGAACTACAG No data
Right 1113575597 13:111393205-111393227 TCTGGTGTCTGCTCTGCCCTGGG No data
1113575592_1113575600 19 Left 1113575592 13:111393173-111393195 CCCTCTCTCCTTATGAACTACAG No data
Right 1113575600 13:111393215-111393237 GCTCTGCCCTGGGACAGGGAAGG No data
1113575592_1113575595 -9 Left 1113575592 13:111393173-111393195 CCCTCTCTCCTTATGAACTACAG No data
Right 1113575595 13:111393187-111393209 GAACTACAGACTTGACTTTCTGG No data
1113575592_1113575599 15 Left 1113575592 13:111393173-111393195 CCCTCTCTCCTTATGAACTACAG No data
Right 1113575599 13:111393211-111393233 GTCTGCTCTGCCCTGGGACAGGG No data
1113575592_1113575598 14 Left 1113575592 13:111393173-111393195 CCCTCTCTCCTTATGAACTACAG No data
Right 1113575598 13:111393210-111393232 TGTCTGCTCTGCCCTGGGACAGG No data
1113575592_1113575603 27 Left 1113575592 13:111393173-111393195 CCCTCTCTCCTTATGAACTACAG No data
Right 1113575603 13:111393223-111393245 CTGGGACAGGGAAGGTCTGCAGG No data
1113575592_1113575596 8 Left 1113575592 13:111393173-111393195 CCCTCTCTCCTTATGAACTACAG No data
Right 1113575596 13:111393204-111393226 TTCTGGTGTCTGCTCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113575592 Original CRISPR CTGTAGTTCATAAGGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr