ID: 1113583526 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:111447118-111447140 |
Sequence | TCCAAGAGTGAGGAGAGAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1113583526_1113583535 | 21 | Left | 1113583526 | 13:111447118-111447140 | CCTGCTCTCTCCTCACTCTTGGA | No data | ||
Right | 1113583535 | 13:111447162-111447184 | GAAGAGATGATCAGAGTACTTGG | No data | ||||
1113583526_1113583530 | -3 | Left | 1113583526 | 13:111447118-111447140 | CCTGCTCTCTCCTCACTCTTGGA | No data | ||
Right | 1113583530 | 13:111447138-111447160 | GGACCACCAAGGTGGCACCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1113583526 | Original CRISPR | TCCAAGAGTGAGGAGAGAGC AGG (reversed) | Intergenic | ||