ID: 1113583526

View in Genome Browser
Species Human (GRCh38)
Location 13:111447118-111447140
Sequence TCCAAGAGTGAGGAGAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113583526_1113583535 21 Left 1113583526 13:111447118-111447140 CCTGCTCTCTCCTCACTCTTGGA No data
Right 1113583535 13:111447162-111447184 GAAGAGATGATCAGAGTACTTGG No data
1113583526_1113583530 -3 Left 1113583526 13:111447118-111447140 CCTGCTCTCTCCTCACTCTTGGA No data
Right 1113583530 13:111447138-111447160 GGACCACCAAGGTGGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113583526 Original CRISPR TCCAAGAGTGAGGAGAGAGC AGG (reversed) Intergenic
No off target data available for this crispr