ID: 1113583530

View in Genome Browser
Species Human (GRCh38)
Location 13:111447138-111447160
Sequence GGACCACCAAGGTGGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113583526_1113583530 -3 Left 1113583526 13:111447118-111447140 CCTGCTCTCTCCTCACTCTTGGA No data
Right 1113583530 13:111447138-111447160 GGACCACCAAGGTGGCACCCTGG No data
1113583524_1113583530 1 Left 1113583524 13:111447114-111447136 CCTTCCTGCTCTCTCCTCACTCT No data
Right 1113583530 13:111447138-111447160 GGACCACCAAGGTGGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113583530 Original CRISPR GGACCACCAAGGTGGCACCC TGG Intergenic
No off target data available for this crispr