ID: 1113583535

View in Genome Browser
Species Human (GRCh38)
Location 13:111447162-111447184
Sequence GAAGAGATGATCAGAGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113583528_1113583535 11 Left 1113583528 13:111447128-111447150 CCTCACTCTTGGACCACCAAGGT No data
Right 1113583535 13:111447162-111447184 GAAGAGATGATCAGAGTACTTGG No data
1113583532_1113583535 -5 Left 1113583532 13:111447144-111447166 CCAAGGTGGCACCCTGGAGAAGA No data
Right 1113583535 13:111447162-111447184 GAAGAGATGATCAGAGTACTTGG No data
1113583526_1113583535 21 Left 1113583526 13:111447118-111447140 CCTGCTCTCTCCTCACTCTTGGA No data
Right 1113583535 13:111447162-111447184 GAAGAGATGATCAGAGTACTTGG No data
1113583531_1113583535 -2 Left 1113583531 13:111447141-111447163 CCACCAAGGTGGCACCCTGGAGA No data
Right 1113583535 13:111447162-111447184 GAAGAGATGATCAGAGTACTTGG No data
1113583524_1113583535 25 Left 1113583524 13:111447114-111447136 CCTTCCTGCTCTCTCCTCACTCT No data
Right 1113583535 13:111447162-111447184 GAAGAGATGATCAGAGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113583535 Original CRISPR GAAGAGATGATCAGAGTACT TGG Intergenic
No off target data available for this crispr