ID: 1113584810

View in Genome Browser
Species Human (GRCh38)
Location 13:111457970-111457992
Sequence GCTAGGGCTGCCCGTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113584810_1113584820 23 Left 1113584810 13:111457970-111457992 CCCACAGCACGGGCAGCCCTAGC No data
Right 1113584820 13:111458016-111458038 GCTCCCCAGCTGTGTGGCCTGGG 0: 2
1: 5
2: 55
3: 358
4: 1629
1113584810_1113584819 22 Left 1113584810 13:111457970-111457992 CCCACAGCACGGGCAGCCCTAGC No data
Right 1113584819 13:111458015-111458037 TGCTCCCCAGCTGTGTGGCCTGG No data
1113584810_1113584818 17 Left 1113584810 13:111457970-111457992 CCCACAGCACGGGCAGCCCTAGC No data
Right 1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG No data
1113584810_1113584821 24 Left 1113584810 13:111457970-111457992 CCCACAGCACGGGCAGCCCTAGC No data
Right 1113584821 13:111458017-111458039 CTCCCCAGCTGTGTGGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113584810 Original CRISPR GCTAGGGCTGCCCGTGCTGT GGG (reversed) Intergenic
No off target data available for this crispr