ID: 1113584814

View in Genome Browser
Species Human (GRCh38)
Location 13:111457994-111458016
Sequence CAGCAGAGCTTGGGGAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113584814_1113584819 -2 Left 1113584814 13:111457994-111458016 CCGCTGCTCCCCAAGCTCTGCTG No data
Right 1113584819 13:111458015-111458037 TGCTCCCCAGCTGTGTGGCCTGG No data
1113584814_1113584825 12 Left 1113584814 13:111457994-111458016 CCGCTGCTCCCCAAGCTCTGCTG No data
Right 1113584825 13:111458029-111458051 GTGGCCTGGGGTGCAGTAACCGG No data
1113584814_1113584826 13 Left 1113584814 13:111457994-111458016 CCGCTGCTCCCCAAGCTCTGCTG No data
Right 1113584826 13:111458030-111458052 TGGCCTGGGGTGCAGTAACCGGG No data
1113584814_1113584818 -7 Left 1113584814 13:111457994-111458016 CCGCTGCTCCCCAAGCTCTGCTG No data
Right 1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG No data
1113584814_1113584821 0 Left 1113584814 13:111457994-111458016 CCGCTGCTCCCCAAGCTCTGCTG No data
Right 1113584821 13:111458017-111458039 CTCCCCAGCTGTGTGGCCTGGGG No data
1113584814_1113584820 -1 Left 1113584814 13:111457994-111458016 CCGCTGCTCCCCAAGCTCTGCTG No data
Right 1113584820 13:111458016-111458038 GCTCCCCAGCTGTGTGGCCTGGG 0: 2
1: 5
2: 55
3: 358
4: 1629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113584814 Original CRISPR CAGCAGAGCTTGGGGAGCAG CGG (reversed) Intergenic
No off target data available for this crispr