ID: 1113584818

View in Genome Browser
Species Human (GRCh38)
Location 13:111458010-111458032
Sequence TCTGCTGCTCCCCAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113584814_1113584818 -7 Left 1113584814 13:111457994-111458016 CCGCTGCTCCCCAAGCTCTGCTG No data
Right 1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG No data
1113584812_1113584818 1 Left 1113584812 13:111457986-111458008 CCCTAGCTCCGCTGCTCCCCAAG No data
Right 1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG No data
1113584811_1113584818 16 Left 1113584811 13:111457971-111457993 CCACAGCACGGGCAGCCCTAGCT No data
Right 1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG No data
1113584810_1113584818 17 Left 1113584810 13:111457970-111457992 CCCACAGCACGGGCAGCCCTAGC No data
Right 1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG No data
1113584813_1113584818 0 Left 1113584813 13:111457987-111458009 CCTAGCTCCGCTGCTCCCCAAGC No data
Right 1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113584818 Original CRISPR TCTGCTGCTCCCCAGCTGTG TGG Intergenic
No off target data available for this crispr