ID: 1113586332

View in Genome Browser
Species Human (GRCh38)
Location 13:111468484-111468506
Sequence GCCGGGCCGGTGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113586332_1113586343 1 Left 1113586332 13:111468484-111468506 CCCAGGACCCTCACCGGCCCGGC No data
Right 1113586343 13:111468508-111468530 GTGGGCCGGTCCAAACCCATGGG No data
1113586332_1113586342 0 Left 1113586332 13:111468484-111468506 CCCAGGACCCTCACCGGCCCGGC No data
Right 1113586342 13:111468507-111468529 TGTGGGCCGGTCCAAACCCATGG No data
1113586332_1113586348 30 Left 1113586332 13:111468484-111468506 CCCAGGACCCTCACCGGCCCGGC No data
Right 1113586348 13:111468537-111468559 GAGCCACTTTCTGCTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113586332 Original CRISPR GCCGGGCCGGTGAGGGTCCT GGG (reversed) Intergenic
No off target data available for this crispr