ID: 1113590100

View in Genome Browser
Species Human (GRCh38)
Location 13:111492713-111492735
Sequence TCACCTTGCTGGTCTCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113590100_1113590114 29 Left 1113590100 13:111492713-111492735 CCTTTAAGAGACCAGCAAGGTGA No data
Right 1113590114 13:111492765-111492787 TGTGCAGCATAAATCTCTGGAGG No data
1113590100_1113590115 30 Left 1113590100 13:111492713-111492735 CCTTTAAGAGACCAGCAAGGTGA No data
Right 1113590115 13:111492766-111492788 GTGCAGCATAAATCTCTGGAGGG No data
1113590100_1113590104 -10 Left 1113590100 13:111492713-111492735 CCTTTAAGAGACCAGCAAGGTGA No data
Right 1113590104 13:111492726-111492748 AGCAAGGTGATTGGAAAGGCCGG No data
1113590100_1113590107 -4 Left 1113590100 13:111492713-111492735 CCTTTAAGAGACCAGCAAGGTGA No data
Right 1113590107 13:111492732-111492754 GTGATTGGAAAGGCCGGGCCGGG No data
1113590100_1113590105 -9 Left 1113590100 13:111492713-111492735 CCTTTAAGAGACCAGCAAGGTGA No data
Right 1113590105 13:111492727-111492749 GCAAGGTGATTGGAAAGGCCGGG No data
1113590100_1113590106 -5 Left 1113590100 13:111492713-111492735 CCTTTAAGAGACCAGCAAGGTGA No data
Right 1113590106 13:111492731-111492753 GGTGATTGGAAAGGCCGGGCCGG No data
1113590100_1113590112 26 Left 1113590100 13:111492713-111492735 CCTTTAAGAGACCAGCAAGGTGA No data
Right 1113590112 13:111492762-111492784 TCCTGTGCAGCATAAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113590100 Original CRISPR TCACCTTGCTGGTCTCTTAA AGG (reversed) Intergenic
No off target data available for this crispr