ID: 1113591366

View in Genome Browser
Species Human (GRCh38)
Location 13:111503503-111503525
Sequence TCCTGATGACCCCAGCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113591366_1113591369 27 Left 1113591366 13:111503503-111503525 CCACTTGGCTGGGGTCATCAGGA No data
Right 1113591369 13:111503553-111503575 TGTCTATGCCACGTCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113591366 Original CRISPR TCCTGATGACCCCAGCCAAG TGG (reversed) Intergenic
No off target data available for this crispr