ID: 1113592280

View in Genome Browser
Species Human (GRCh38)
Location 13:111509370-111509392
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113592273_1113592280 13 Left 1113592273 13:111509334-111509356 CCAGAGGGATGGAAGTTAGAGGC No data
Right 1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113592280 Original CRISPR CGGCGATCAGCAGTGGTAGA CGG Intergenic
No off target data available for this crispr