ID: 1113594090

View in Genome Browser
Species Human (GRCh38)
Location 13:111519259-111519281
Sequence AAGCCAGAAGGTGAGTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113594090_1113594099 27 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594099 13:111519309-111519331 CTGCTGACTCCAGGTGGGAATGG No data
1113594090_1113594094 4 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594094 13:111519286-111519308 TCCTGCATCTGGTGAAGCAGTGG No data
1113594090_1113594092 -7 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594092 13:111519275-111519297 CTGGCTTCTCCTCCTGCATCTGG No data
1113594090_1113594097 21 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594097 13:111519303-111519325 CAGTGGCTGCTGACTCCAGGTGG No data
1113594090_1113594096 18 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594096 13:111519300-111519322 AAGCAGTGGCTGCTGACTCCAGG No data
1113594090_1113594098 22 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594098 13:111519304-111519326 AGTGGCTGCTGACTCCAGGTGGG No data
1113594090_1113594101 29 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594101 13:111519311-111519333 GCTGACTCCAGGTGGGAATGGGG No data
1113594090_1113594100 28 Left 1113594090 13:111519259-111519281 CCTCTGGACTCACCTTCTGGCTT No data
Right 1113594100 13:111519310-111519332 TGCTGACTCCAGGTGGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113594090 Original CRISPR AAGCCAGAAGGTGAGTCCAG AGG (reversed) Intergenic
No off target data available for this crispr