ID: 1113594878

View in Genome Browser
Species Human (GRCh38)
Location 13:111524060-111524082
Sequence AAGTAGCCACAGATGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113594878_1113594883 15 Left 1113594878 13:111524060-111524082 CCTAGCTTCATCTGTGGCTACTT No data
Right 1113594883 13:111524098-111524120 GCTATTGTAGGACCATTTAGGGG No data
1113594878_1113594882 14 Left 1113594878 13:111524060-111524082 CCTAGCTTCATCTGTGGCTACTT No data
Right 1113594882 13:111524097-111524119 AGCTATTGTAGGACCATTTAGGG No data
1113594878_1113594880 3 Left 1113594878 13:111524060-111524082 CCTAGCTTCATCTGTGGCTACTT No data
Right 1113594880 13:111524086-111524108 CTTCACTCTTCAGCTATTGTAGG No data
1113594878_1113594881 13 Left 1113594878 13:111524060-111524082 CCTAGCTTCATCTGTGGCTACTT No data
Right 1113594881 13:111524096-111524118 CAGCTATTGTAGGACCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113594878 Original CRISPR AAGTAGCCACAGATGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr