ID: 1113597424

View in Genome Browser
Species Human (GRCh38)
Location 13:111543528-111543550
Sequence CCCTGTTAAGCTCTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113597424_1113597433 24 Left 1113597424 13:111543528-111543550 CCCCATCACAGAGCTTAACAGGG No data
Right 1113597433 13:111543575-111543597 ACGCCCACCCTCCCTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113597424 Original CRISPR CCCTGTTAAGCTCTGTGATG GGG (reversed) Intergenic
No off target data available for this crispr