ID: 1113598519

View in Genome Browser
Species Human (GRCh38)
Location 13:111551477-111551499
Sequence CAATTTAATTAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113598513_1113598519 13 Left 1113598513 13:111551441-111551463 CCTCTGCTTGGGCCTCTGCAGGC No data
Right 1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG No data
1113598514_1113598519 1 Left 1113598514 13:111551453-111551475 CCTCTGCAGGCTTCATACAGAAG No data
Right 1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113598519 Original CRISPR CAATTTAATTAGAGGGCAGT GGG Intergenic
No off target data available for this crispr