ID: 1113599090

View in Genome Browser
Species Human (GRCh38)
Location 13:111555436-111555458
Sequence GGCACTGTTGGCAGAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113599082_1113599090 4 Left 1113599082 13:111555409-111555431 CCCTGGGGAGCACTTTAGGCCTT No data
Right 1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG No data
1113599081_1113599090 5 Left 1113599081 13:111555408-111555430 CCCCTGGGGAGCACTTTAGGCCT No data
Right 1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG No data
1113599076_1113599090 27 Left 1113599076 13:111555386-111555408 CCTGTCTCAGCAGAGGGCACTGC No data
Right 1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG No data
1113599083_1113599090 3 Left 1113599083 13:111555410-111555432 CCTGGGGAGCACTTTAGGCCTTT No data
Right 1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG No data
1113599075_1113599090 28 Left 1113599075 13:111555385-111555407 CCCTGTCTCAGCAGAGGGCACTG No data
Right 1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113599090 Original CRISPR GGCACTGTTGGCAGAGTTCC TGG Intergenic