ID: 1113601927

View in Genome Browser
Species Human (GRCh38)
Location 13:111575638-111575660
Sequence CCAGATCAAAACGGGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113601915_1113601927 13 Left 1113601915 13:111575602-111575624 CCTCTTCTACTCCAGTTCCCATC No data
Right 1113601927 13:111575638-111575660 CCAGATCAAAACGGGGACCTGGG No data
1113601919_1113601927 -5 Left 1113601919 13:111575620-111575642 CCATCTTCTCTCTGGTCCCCAGA No data
Right 1113601927 13:111575638-111575660 CCAGATCAAAACGGGGACCTGGG No data
1113601918_1113601927 -4 Left 1113601918 13:111575619-111575641 CCCATCTTCTCTCTGGTCCCCAG No data
Right 1113601927 13:111575638-111575660 CCAGATCAAAACGGGGACCTGGG No data
1113601917_1113601927 2 Left 1113601917 13:111575613-111575635 CCAGTTCCCATCTTCTCTCTGGT No data
Right 1113601927 13:111575638-111575660 CCAGATCAAAACGGGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113601927 Original CRISPR CCAGATCAAAACGGGGACCT GGG Intergenic
No off target data available for this crispr