ID: 1113604079

View in Genome Browser
Species Human (GRCh38)
Location 13:111592419-111592441
Sequence TGTCCGCTAAAACTTTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113604079_1113604081 -8 Left 1113604079 13:111592419-111592441 CCACCACAAAGTTTTAGCGGACA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1113604081 13:111592434-111592456 AGCGGACAGTGCTGCTCTAGAGG 0: 1
1: 5
2: 3
3: 24
4: 119
1113604079_1113604082 -7 Left 1113604079 13:111592419-111592441 CCACCACAAAGTTTTAGCGGACA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1113604082 13:111592435-111592457 GCGGACAGTGCTGCTCTAGAGGG 0: 1
1: 6
2: 4
3: 14
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113604079 Original CRISPR TGTCCGCTAAAACTTTGTGG TGG (reversed) Intronic
901427772 1:9193610-9193632 GGTCCCCTAAAACATGGTGGTGG - Intergenic
904849404 1:33446128-33446150 TCTCCAGTAAAACTCTGTGGGGG + Intergenic
908918846 1:69166078-69166100 TGTCAGGTAAGACTTTTTGGAGG + Intergenic
915592188 1:156876810-156876832 CGTGAGCTAAAACTTTGGGGTGG + Intronic
919267829 1:195295127-195295149 TGTGCACTAAAAGTTTGGGGTGG + Intergenic
1071272421 10:84020199-84020221 AGTCCACTTAAACTTGGTGGGGG + Intergenic
1077872669 11:6275732-6275754 GGTCTGCTAATATTTTGTGGAGG - Intergenic
1079849994 11:25520556-25520578 TGTTAGCTGAAACTTTGTGCTGG + Intergenic
1081356224 11:42117544-42117566 GGTCCACTAAAACTTCATGGAGG + Intergenic
1086078090 11:82876045-82876067 TGTCCTAGAAAACTTTGTAGAGG - Intronic
1088341729 11:108776315-108776337 TGTCAGCCAAGAATTTGTGGAGG + Intronic
1090988836 11:131797872-131797894 TGACTGCTTAAAATTTGTGGAGG - Intronic
1102028615 12:109727373-109727395 TGTCGGCCAAACCTCTGTGGAGG - Intronic
1102764346 12:115419100-115419122 CCTCAGCCAAAACTTTGTGGGGG - Intergenic
1105493885 13:20913181-20913203 TGTTCGCTAGAATTTTGTTGAGG - Intergenic
1106610677 13:31276559-31276581 TCTCCCCTAAAACTTTATGCCGG + Intronic
1108602308 13:52005405-52005427 TGTGCCCTAATGCTTTGTGGAGG - Intronic
1113604079 13:111592419-111592441 TGTCCGCTAAAACTTTGTGGTGG - Intronic
1118099907 14:62586157-62586179 TATTTGCTAAAATTTTGTGGAGG + Intergenic
1120755412 14:88239442-88239464 TGTCCACCAAAACTTTGTGTTGG + Intronic
1126142121 15:45447302-45447324 TGTCCGTTCAAACTATTTGGAGG + Intronic
1130782888 15:87063475-87063497 TTTTTTCTAAAACTTTGTGGGGG + Intergenic
1132111173 15:99103256-99103278 TTTCTGCTAAAACTAAGTGGGGG - Intronic
1133255704 16:4514473-4514495 TGCCCGCTAAACGTTTGGGGAGG - Intronic
1133696642 16:8269921-8269943 AGTCCGCTAGTATTTTGTGGAGG + Intergenic
1143461365 17:7106352-7106374 TGACCACTACAACTTCGTGGTGG - Intronic
1144099614 17:11932172-11932194 TGTCCTCTACAACTTCCTGGAGG + Exonic
1144240015 17:13301443-13301465 TGTCTGCTAAAAATTTGTATGGG - Intergenic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149320322 17:55475051-55475073 TGTCCTCTTAAACACTGTGGGGG - Intergenic
1149406487 17:56357091-56357113 TGTCCTTTACAACTTTGTGATGG - Intronic
1159065785 18:63566825-63566847 TATCCACAAAACCTTTGTGGAGG + Exonic
1168339961 19:55617074-55617096 TCTCCGCCAAAACTTACTGGGGG - Exonic
930603537 2:53469221-53469243 TGTCGGGGAAAACTTTGTGGGGG - Intergenic
939235110 2:139481290-139481312 TGTTCGCTAAAGCTGAGTGGTGG + Intergenic
947021569 2:225683181-225683203 TTTCAGCAAAAACTTTTTGGTGG + Intergenic
1173742779 20:45413204-45413226 TTTCCACTAAAAATATGTGGTGG - Intergenic
1176308401 21:5136377-5136399 TGTCCCCTAAATGTTTCTGGGGG - Intronic
1176970254 21:15256589-15256611 TTCCCCCTAAAACTTTGTAGTGG + Intergenic
1179848659 21:44125655-44125677 TGTCCCCTAAATGTTTCTGGGGG + Intronic
952177479 3:30880770-30880792 TGTACTCTAAAATTTTATGGAGG + Intronic
957808270 3:85180858-85180880 TGTCAGCCAAAACTTTTTTGTGG - Intronic
960019228 3:112931237-112931259 TGTTGGATAAGACTTTGTGGAGG - Intronic
961832414 3:129630597-129630619 TGTAGGCTCAAAGTTTGTGGGGG + Intergenic
964352278 3:155815046-155815068 TTTCCATTAAAACTATGTGGAGG - Intergenic
964636661 3:158865451-158865473 TCTCGGCTAAATCTTGGTGGTGG + Intergenic
965245712 3:166264747-166264769 TGTCCTGTAAAATATTGTGGTGG + Intergenic
967639215 3:191840766-191840788 TATCTGCTAAAACCTTGTGTAGG - Intergenic
971906675 4:32735250-32735272 GGACCTCTAAAACTCTGTGGAGG - Intergenic
976561388 4:86505441-86505463 TCTCTACTAAAAATTTGTGGTGG + Intronic
978071484 4:104477523-104477545 TTTCTGCTAAAAACTTGTGGGGG - Intronic
978389729 4:108212974-108212996 TGTCCTTTAAATGTTTGTGGAGG - Intergenic
978800517 4:112751536-112751558 TGTCAGGGAAAACTGTGTGGAGG + Intergenic
980624007 4:135348277-135348299 AGTCTGCTAATACTTTGTTGAGG - Intergenic
984521257 4:180803877-180803899 TCTCTCCTAAAACTTTGTGATGG - Intergenic
985201750 4:187491201-187491223 TCTCCCCTAAAACTTTATGATGG - Intergenic
992136650 5:73752812-73752834 TGTCTGCTTAAGCTATGTGGTGG + Intronic
994766776 5:103928320-103928342 TTTCTGCTAAAACTTTTTAGGGG + Intergenic
997527744 5:134564397-134564419 TGTCTGCTGAAACTAGGTGGTGG - Intronic
998095134 5:139392396-139392418 CGGCCGCTACTACTTTGTGGAGG - Exonic
999365967 5:151023657-151023679 TGGCCACTAGATCTTTGTGGCGG + Intronic
999371710 5:151059479-151059501 TGTCAGCCAAACCTTTGTGAAGG + Intronic
1000190714 5:158908036-158908058 TGTCTGCCAAAACTCGGTGGTGG - Intronic
1002719305 5:181247961-181247983 TGCCAGCTAAAACTCTGTGCAGG + Intronic
1004826869 6:19432332-19432354 TGTACCCTAAAACTTTGTCTGGG + Intergenic
1008440723 6:51529296-51529318 TGTCCTTTAAAATTTTGAGGAGG - Intergenic
1008813735 6:55537791-55537813 TGTCCTCAAAAGCTATGTGGGGG + Intronic
1009692491 6:67054380-67054402 TGTGCTCTAAAACTTTGTGTGGG - Intergenic
1010490230 6:76466997-76467019 TGCCAGCTAACAGTTTGTGGAGG - Intergenic
1023881538 7:44324180-44324202 TGTCTGGTGAAACCTTGTGGTGG - Intronic
1027935390 7:84595427-84595449 AGCTCGCTAGAACTTTGTGGAGG - Intergenic
1035875950 8:3189867-3189889 TGCCCGCCAGAACTCTGTGGTGG - Intronic
1038892329 8:31739572-31739594 TGTGTGCTAAAACATTGTTGTGG + Intronic
1045109220 8:98924135-98924157 TGTCCCTGAAAATTTTGTGGAGG + Intronic
1047990751 8:130283989-130284011 TATCCACAAAAACCTTGTGGAGG + Intronic
1059382759 9:113940563-113940585 TGTCAGTTAAAATTTTGGGGGGG + Intronic
1060158612 9:121338809-121338831 AGTCAGTTAAAGCTTTGTGGTGG + Intergenic
1061440195 9:130597284-130597306 AGTCCTCTAGAACTTTTTGGAGG - Intronic
1061706726 9:132458603-132458625 TGTCCGGTGGAACTTTCTGGAGG + Intronic
1190356191 X:49607596-49607618 TATCCCCTCAAACTTTGTGAGGG + Exonic
1193252889 X:79313319-79313341 AGTCTGCTAGTACTTTGTGGAGG - Intergenic
1196719281 X:118838970-118838992 TGTCTGCTAAAACCTTCAGGTGG + Intergenic