ID: 1113605762

View in Genome Browser
Species Human (GRCh38)
Location 13:111604240-111604262
Sequence TGGACTGATGCTGCCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113605753_1113605762 15 Left 1113605753 13:111604202-111604224 CCCTCTCATCCCTTCTCGGCGAT 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605754_1113605762 14 Left 1113605754 13:111604203-111604225 CCTCTCATCCCTTCTCGGCGATG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605758_1113605762 -9 Left 1113605758 13:111604226-111604248 CCACCGCGTCCTCCTGGACTGAT 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605755_1113605762 6 Left 1113605755 13:111604211-111604233 CCCTTCTCGGCGATGCCACCGCG 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605756_1113605762 5 Left 1113605756 13:111604212-111604234 CCTTCTCGGCGATGCCACCGCGT 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113605762 Original CRISPR TGGACTGATGCTGCCTCTTC TGG Intronic
900537641 1:3186816-3186838 TGGAGTGCAGCTGCCTGTTCTGG - Intronic
900949082 1:5847549-5847571 TCGCCTGATGCTGCTTCTTGGGG + Intergenic
902627321 1:17684181-17684203 TGGGCTGATGCTGCCTCAGCTGG + Intronic
904120832 1:28196749-28196771 TGGACTTTAGCTGCCTCCTCTGG - Intergenic
904978038 1:34473425-34473447 TGGACTGATGTTGTCTCTTCAGG + Intergenic
911056806 1:93715739-93715761 TAGACAGATGGTGGCTCTTCAGG + Intronic
912124441 1:106516749-106516771 TGGAATTATGCTTCCTCTCCAGG + Intergenic
916488405 1:165279606-165279628 GGGGCTGATGCTGCCTGTCCAGG + Intronic
917164348 1:172095612-172095634 CCGACTGATGCTGGCTTTTCTGG + Intronic
918708307 1:187696203-187696225 TGGGCTGCTGCAGCCTCTGCAGG + Intergenic
918898201 1:190376107-190376129 AGAACTAATTCTGCCTCTTCAGG + Intronic
920269556 1:204752569-204752591 GGGACTCGTGGTGCCTCTTCTGG + Intergenic
920530630 1:206699501-206699523 GGGAGAGATGCTGCCTCTCCAGG + Intronic
920816245 1:209335265-209335287 TTCACTGTTGCTGCCCCTTCTGG + Intergenic
1063610642 10:7558975-7558997 TTGACTGATGCTGCTTCCACTGG - Intergenic
1063911468 10:10834853-10834875 TTGTCCGATGCTGCCTCTCCAGG + Intergenic
1065197272 10:23278673-23278695 AGGTCAGATGCTGCCTCCTCTGG - Intronic
1067087343 10:43249865-43249887 GGGTCTGATGCTGCCTAATCAGG + Intronic
1067252817 10:44602046-44602068 TGGACTGGTTCTGCCTCGTCAGG + Intergenic
1069492079 10:68869589-68869611 TGGACAGATACTGACTATTCAGG + Intronic
1069732026 10:70623083-70623105 GGGACTTGTGGTGCCTCTTCTGG + Intergenic
1070322269 10:75363167-75363189 TGGACTGGAGCCTCCTCTTCTGG - Intergenic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1072741742 10:97914062-97914084 TGGACAGATGCTGCCTCAAAGGG + Intronic
1074711977 10:116184934-116184956 TGGATTGATGATGCCACCTCTGG - Intronic
1074919733 10:117994934-117994956 AAGACTGATGCTGCCTCTGCTGG - Intergenic
1075043744 10:119129184-119129206 TTGACTGATGTTCCCCCTTCAGG - Intronic
1076420035 10:130324772-130324794 TGGCCTGATGCTGCCTCTCAGGG - Intergenic
1076698311 10:132257552-132257574 TGGCAGGATGCTGCCTGTTCTGG + Intronic
1077418454 11:2436813-2436835 TGGTCTCATGCTCCCTGTTCTGG - Intergenic
1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG + Intronic
1081852883 11:46285857-46285879 TGGAGTGAGGCAGGCTCTTCAGG + Intronic
1081903418 11:46649363-46649385 TGGACTGATGTTCCCTCTGAAGG - Intronic
1084072968 11:66749099-66749121 TGGATTGAAGTTGCCCCTTCAGG + Intronic
1084868434 11:72079593-72079615 TGGGTTGATGCTGCCGCCTCTGG - Intronic
1084943193 11:72625265-72625287 TGCACTGGTGCTGGCTCTACTGG + Intronic
1084991131 11:72926230-72926252 GGGACTGGTGGTGCCTCTTCTGG + Intronic
1085793141 11:79513417-79513439 TGGACTGATGCTTCCCCAGCTGG - Intergenic
1089339385 11:117747171-117747193 TCTACTGATGCTTCCTCTTGCGG + Intronic
1089409393 11:118226855-118226877 AGGAATGGAGCTGCCTCTTCTGG + Exonic
1090839772 11:130477710-130477732 TAGACTCATGCAGCCTCTTCTGG - Intergenic
1091331526 11:134735100-134735122 AGGACTGAAGCTGAGTCTTCGGG + Intergenic
1093059597 12:14589164-14589186 GGGACTCATGGTGCTTCTTCTGG - Intergenic
1093062327 12:14620151-14620173 TGGCCTGAGGCTGCCTCTTAGGG + Intronic
1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG + Intronic
1094144475 12:27214297-27214319 GGGACTTGTGGTGCCTCTTCTGG + Intergenic
1094345542 12:29464508-29464530 TGCACTGATGCTTCCCCATCCGG + Exonic
1097021411 12:56023159-56023181 TCGGCTGAGGCTGCCTCTTGAGG - Intronic
1100672840 12:96835398-96835420 GGGACTTATGGTGCCTTTTCCGG - Intronic
1101842722 12:108339719-108339741 TGGTCTCCTACTGCCTCTTCAGG + Intergenic
1103515020 12:121502000-121502022 TTCATTGATGCGGCCTCTTCTGG - Intronic
1106185468 13:27405878-27405900 AGGACTCATGTTGCCTCTCCTGG - Intergenic
1107875829 13:44789902-44789924 GGGACTCATGGTGCCTCTTCCGG - Intergenic
1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG + Intronic
1115184731 14:30673264-30673286 TGAACTGATTCTGCAACTTCTGG - Exonic
1117529648 14:56647314-56647336 TGAGCGGATGCTGCGTCTTCAGG + Exonic
1118908986 14:70045833-70045855 GGTCCTGATGCTGCCTCTCCAGG + Exonic
1118960046 14:70521362-70521384 TTGACAGATGCTGACTCTTCAGG - Intergenic
1119162852 14:72467641-72467663 TGCACTGCTTCTTCCTCTTCTGG - Intronic
1121870382 14:97401729-97401751 TGGCATGATGCTGACTCTTCTGG - Intergenic
1122287880 14:100663062-100663084 TGGCCTGGTGGGGCCTCTTCCGG + Intergenic
1122627993 14:103094042-103094064 AGGGGTGAGGCTGCCTCTTCTGG + Intergenic
1124082684 15:26516331-26516353 TCCACAGATGCTGCCTCTCCAGG - Intergenic
1124937583 15:34186914-34186936 GGGACTCGTGGTGCCTCTTCCGG + Intronic
1126954596 15:53918490-53918512 TGGACTGATGCTGCGTCTGAGGG - Intergenic
1130028991 15:80295158-80295180 GGGACTCATGGTGCCTCTTCTGG - Intergenic
1130082331 15:80744940-80744962 TGGTCTGATGTTGCCTCATGAGG + Intronic
1130322529 15:82853040-82853062 AGGACTGCTGCTGCCTGTTCGGG - Intronic
1131899520 15:97072434-97072456 TGAAGTGATGTTGCCTCTTGGGG - Intergenic
1135304096 16:21354260-21354282 TCAACTGAAGCTGCCTTTTCTGG + Intergenic
1136300832 16:29333395-29333417 TCAACTGAAGCTGCCTTTTCTGG + Intergenic
1136429138 16:30186836-30186858 GGGCCTGATGCTGCCCCTGCGGG + Exonic
1143605887 17:7985459-7985481 TGGACTGATGCTGCCAGCCCTGG + Intergenic
1144109355 17:12017355-12017377 GTGACGGATGTTGCCTCTTCAGG - Intergenic
1144385071 17:14741706-14741728 CAGACTGATGCTGACTCATCTGG - Intergenic
1145230853 17:21172289-21172311 TGGCCTTCTGCTGCCGCTTCGGG - Intronic
1146593217 17:34146678-34146700 TTGACAGGTGCTGCCTCTTCTGG - Intronic
1146761509 17:35482856-35482878 GGGACTTGTGGTGCCTCTTCTGG + Intronic
1149160419 17:53686895-53686917 GGGACTCATGGTGCCTCTTCCGG - Intergenic
1149667793 17:58377983-58378005 TGGCCTGAAGTTGCTTCTTCCGG + Intronic
1150413617 17:64968347-64968369 TGGATTGATGATGAATCTTCTGG - Intergenic
1151769573 17:76151183-76151205 GGAACTGATACTGCCTCTTTTGG + Intronic
1152182093 17:78828882-78828904 TGGATTGATGCTTACTTTTCAGG + Exonic
1152728082 17:81957475-81957497 TGGACTAATGCTCCTTCTCCAGG - Intronic
1154372081 18:13773499-13773521 AGGACTGAAGCAGCCTCTTGAGG + Intergenic
1155120698 18:22816393-22816415 GGGACTCGTGGTGCCTCTTCTGG - Intronic
1156734381 18:40235539-40235561 AGGGCTGATGCTGCTTGTTCAGG + Intergenic
1159088207 18:63818376-63818398 TGGACTGAAGCTCTGTCTTCTGG + Intergenic
1160030771 18:75257700-75257722 TGGCCTGATGCTTCCTCATCAGG - Intronic
1160737064 19:667736-667758 TGGACTGTGGCTGCCTCCTGAGG + Intergenic
1164602973 19:29576019-29576041 TGCAATGAGGCTGCCACTTCTGG - Intergenic
1168144167 19:54410367-54410389 GGCAGTGATGCTGCCTCCTCCGG - Intergenic
925024081 2:594396-594418 TGTGCTGGTGCTGGCTCTTCAGG - Intergenic
931138767 2:59434059-59434081 TGGCCTGAAGCTGCTACTTCTGG + Intergenic
932777469 2:74536723-74536745 TCGACTGTTGTTGCTTCTTCTGG + Exonic
935042310 2:99444416-99444438 TGGAGTGATGCAGACTCTACAGG + Intronic
936607356 2:113971811-113971833 TGAAGTAGTGCTGCCTCTTCGGG + Intergenic
937478028 2:122232278-122232300 TGGACTGATGAACCCTCTTTTGG - Intergenic
938789124 2:134661017-134661039 TGGATTGATGCTGTCACTGCAGG + Intronic
940074130 2:149721632-149721654 TGGACTGATGTGGCCTCCTGAGG - Intergenic
940725327 2:157329983-157330005 TGGGATGATCCTGTCTCTTCAGG - Intergenic
942169180 2:173273098-173273120 TTGCCAGATGATGCCTCTTCTGG + Intergenic
943108718 2:183579703-183579725 TGGAATGAAGTTGCCTCCTCCGG + Intergenic
944586667 2:201178969-201178991 GGGACTCATGGTGCCTCTTCTGG + Intergenic
946282442 2:218675891-218675913 GGGACTGCTGCTGGGTCTTCTGG + Intronic
946789374 2:223285112-223285134 GGGACTCATGGTGCCTCTTCTGG - Intergenic
949046030 2:241873070-241873092 TGGACCTCAGCTGCCTCTTCTGG - Exonic
1172659087 20:36555058-36555080 TGAACTGTTCCTGCCCCTTCTGG - Intergenic
1173090541 20:39966678-39966700 TGGAGTTATGCTGCCTCATAGGG + Intergenic
1173280198 20:41620241-41620263 TCGCCTGCTGCTGCCTCTTGGGG + Intergenic
1177751002 21:25283911-25283933 TGCACTGAGGCTCCCCCTTCTGG - Intergenic
1179299486 21:40093749-40093771 TTCACTGCTGTTGCCTCTTCCGG + Exonic
1180642995 22:17314460-17314482 TGGACTCATGCTGCCTGTGTAGG - Intergenic
1181260536 22:21594002-21594024 TGGACAGATGGTGCAGCTTCCGG - Intronic
1181328488 22:22070131-22070153 TGGACAGATCCTCCCTTTTCAGG + Intergenic
1181993420 22:26855800-26855822 TGGACTCATGTAGCCTCATCTGG + Intergenic
1185270706 22:49928309-49928331 TGGGCTGTGGCTGCCTCTGCGGG - Intergenic
951189824 3:19755198-19755220 TGAAGTCATGCTGCCTTTTCTGG + Intergenic
951846952 3:27094951-27094973 TGGTCAGCTGCTGCCTATTCAGG + Intergenic
953512884 3:43560887-43560909 AGCAATGCTGCTGCCTCTTCAGG + Intronic
953610806 3:44445912-44445934 TGGACCGCTGCTGCCTATGCAGG + Exonic
954030688 3:47818029-47818051 TGCACTGACGCTGCCTGTGCTGG - Exonic
954131335 3:48562695-48562717 TGGACGGATGCTGCCACATCTGG - Exonic
955103162 3:55871564-55871586 TGGCCGAATGGTGCCTCTTCCGG - Intronic
955190379 3:56756092-56756114 TGGACTTCTGCGGCCTCTTTGGG - Intronic
955241516 3:57182724-57182746 GGGACTCATGGTACCTCTTCTGG - Intergenic
955813128 3:62812774-62812796 TGGTCTGATGCTCTCTCTTATGG - Intronic
955952321 3:64254918-64254940 TGGAATGATGATGCCCCTACAGG + Intronic
956110620 3:65866921-65866943 TGGACTGCTGCTGGCTGTCCCGG + Intronic
957751881 3:84430485-84430507 TATATTGATGCTCCCTCTTCAGG + Intergenic
960703291 3:120458099-120458121 TCTCCTGGTGCTGCCTCTTCAGG - Intergenic
962440887 3:135415212-135415234 TGGACTGACACTGCCTCCTGAGG + Intergenic
963455203 3:145537816-145537838 GGAAGTTATGCTGCCTCTTCTGG - Intergenic
965347598 3:167571174-167571196 TGGAGTGATGCTGTTTCTTGAGG - Intronic
968512069 4:1000191-1000213 TGCACTCATGTTGCCTCTTGGGG + Intronic
970445640 4:16121276-16121298 AGGACAGATGCTGCATCTTTGGG + Intergenic
970937634 4:21593254-21593276 TTAACTTATGCTGCCACTTCTGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980077675 4:128310524-128310546 AGGACAGATGCTCCCTCTGCTGG - Intergenic
982465646 4:155727190-155727212 TGGGCTGTTGCTGCCTTTTTTGG + Intronic
982547439 4:156752131-156752153 AGGACTGAGTCTGCTTCTTCTGG - Intergenic
982776260 4:159444556-159444578 CTGCTTGATGCTGCCTCTTCTGG + Intergenic
983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
983878427 4:172904463-172904485 TGGGATGAGGCTGTCTCTTCTGG + Intronic
984620021 4:181942092-181942114 AGGACTCAGGCCGCCTCTTCTGG + Intergenic
986601341 5:9476256-9476278 TGATCTGATGCTTCCACTTCTGG - Intronic
986604127 5:9504632-9504654 TGTGCTGATGCCTCCTCTTCAGG - Intronic
987908673 5:24113122-24113144 TGGACTGCTGCTGGCACTTCTGG + Intronic
990632287 5:57683706-57683728 TGGACTTATTCTAACTCTTCAGG - Intergenic
995964004 5:117882148-117882170 TGGACTGGAGCTGCCTGTACTGG - Intergenic
996302266 5:122002586-122002608 TGGACTGATGATTCCTCCTTAGG - Intronic
997241748 5:132312768-132312790 TGCTGTGATGCTGCCTCCTCAGG - Intronic
999859913 5:155633839-155633861 GGGACCCATGATGCCTCTTCTGG + Intergenic
1000186625 5:158864867-158864889 TAGAATGATCCTGCCTCTCCTGG - Intronic
1001718774 5:173839548-173839570 TGGATTGAAGGTGCCTATTCTGG - Intergenic
1002541484 5:179908828-179908850 TGGACTGGCGCTGCCCCTGCAGG - Intergenic
1002693389 5:181066578-181066600 GGGACTCGTGGTGCCTCTTCTGG - Intergenic
1004061076 6:12198709-12198731 TGAACTGTTGTTGCCTCCTCAGG - Intergenic
1004343636 6:14828816-14828838 AGGACTGCTGTGGCCTCTTCTGG - Intergenic
1006500926 6:34458252-34458274 GGGACTCATGGTGCCTCTTCTGG + Intergenic
1010166932 6:72926044-72926066 TGCTCAGATGCAGCCTCTTCTGG - Intronic
1013375522 6:109510150-109510172 GGGACTCGTGGTGCCTCTTCTGG + Intronic
1013612363 6:111807047-111807069 TGGAATGTTGATGCCTTTTCTGG + Intronic
1014249020 6:119097049-119097071 TGGACTCTTATTGCCTCTTCTGG - Intronic
1015058933 6:128938924-128938946 TGCACTGTTGTTACCTCTTCAGG + Intronic
1015352756 6:132242014-132242036 TGCAATGATGCTGATTCTTCAGG + Intergenic
1015986098 6:138885538-138885560 TGGTCTTATCATGCCTCTTCAGG - Exonic
1018825715 6:167406679-167406701 GGGGCTGAGGCTGACTCTTCAGG - Intergenic
1019273191 7:162033-162055 TGGACTGAGGCTGCCTGGACGGG + Intergenic
1021561408 7:21972107-21972129 GGGACTCATGGTGCCTCTTCCGG - Intergenic
1022565060 7:31391398-31391420 TGGAATGAACTTGCCTCTTCTGG + Intergenic
1023645726 7:42312596-42312618 TGCACTGAAGCTGGCTCTGCTGG + Intergenic
1023789120 7:43737786-43737808 GGGACTCATGGTGCCTCTTCCGG + Intergenic
1026913025 7:74103403-74103425 TTGACTGATGTTTCCTCTTAGGG + Intronic
1028181520 7:87730355-87730377 TGGTCTGATTCTCTCTCTTCAGG - Intronic
1028233319 7:88330604-88330626 GGGACTCCTGGTGCCTCTTCTGG + Intergenic
1031260109 7:119507402-119507424 TGATCTGATTCTGTCTCTTCAGG - Intergenic
1032465974 7:132145288-132145310 TGGACGTATCCTGCCTCTCCAGG - Exonic
1035450986 7:158976594-158976616 GGGACTCTTGATGCCTCTTCTGG + Intergenic
1035482481 7:159198369-159198391 TGGACAGAGGCTGCCTCAGCAGG + Intergenic
1035819733 8:2578648-2578670 TGGACAGGTCCTGACTCTTCCGG + Intergenic
1036542320 8:9729078-9729100 TGTCTTGTTGCTGCCTCTTCTGG + Intronic
1038197394 8:25380906-25380928 TGGAATGGTGCTGCCTCCACTGG - Intronic
1039579839 8:38655838-38655860 TGGTCTGATTCGGCCTCTCCAGG + Intergenic
1039651888 8:39350560-39350582 GGGCCTGATGCTTTCTCTTCTGG - Intergenic
1040109034 8:43558011-43558033 TGGTCTCAGGCTTCCTCTTCTGG + Intergenic
1041549456 8:59083203-59083225 TGCATTTATGCAGCCTCTTCTGG - Intronic
1042396063 8:68292917-68292939 GGGACTCATGGTGCCTCTTCTGG + Intergenic
1043626253 8:82263043-82263065 AGGGCTGATGCTTTCTCTTCTGG + Intergenic
1047096762 8:121634346-121634368 AGGTCTGATGATACCTCTTCTGG + Intronic
1048474893 8:134734154-134734176 TGGGCTGCTTCTGCCACTTCAGG + Intergenic
1048586862 8:135782389-135782411 TGGAGTGATGCTGCAGCTTTTGG + Intergenic
1049021748 8:139961749-139961771 GGGACTTGTGCTGCCTCTTCTGG + Intronic
1049761894 8:144335541-144335563 GAGACTGCTGCTGCCTCTGCTGG + Intronic
1052797538 9:32937463-32937485 TGGACTAATACAGCCTCTTTAGG - Intergenic
1053117616 9:35519425-35519447 TAGACTGATGGTGCTTCTCCTGG - Intronic
1053472697 9:38358200-38358222 CTGCTTGATGCTGCCTCTTCTGG + Intergenic
1054760311 9:68998899-68998921 TGGTCTGCTTCTGCCTCTGCTGG + Intronic
1055323583 9:75105596-75105618 TGGACTGATCTTGCCTTTTGCGG + Intronic
1055610620 9:78020598-78020620 CAGACCAATGCTGCCTCTTCTGG - Intronic
1057860015 9:98633682-98633704 TGGTCTGATGCTCTGTCTTCTGG - Intronic
1059855681 9:118394882-118394904 TGGCATGATGCTGTCTCCTCTGG + Intergenic
1059910998 9:119044145-119044167 TGGAATGATTCTTCCACTTCAGG - Intergenic
1060809968 9:126606174-126606196 TGGACTGGTGCAGCCTCCCCAGG - Intergenic
1187298813 X:18028354-18028376 TGGAATTATTCTGCCTGTTCAGG - Intergenic
1189104572 X:38222256-38222278 TCCACTGCTGCTACCTCTTCAGG + Intronic
1189368395 X:40407822-40407844 AGGACTAATGTGGCCTCTTCGGG + Intergenic
1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
1190755351 X:53396542-53396564 TGGCCAGATGCTGATTCTTCAGG + Exonic
1191634133 X:63358107-63358129 TGGGCTGATGCTGCAGCTTTAGG - Intergenic
1192369334 X:70500259-70500281 TGGACAGATGTGGCCTTTTCTGG + Intronic
1194380285 X:93181845-93181867 TGGACTTGTGATGCCTATTCTGG + Intergenic
1198964608 X:142214537-142214559 TGGCCTGATACTCACTCTTCAGG + Intergenic
1200018079 X:153180607-153180629 GAGACTGAGGCTGCCACTTCTGG + Intronic