ID: 1113605762

View in Genome Browser
Species Human (GRCh38)
Location 13:111604240-111604262
Sequence TGGACTGATGCTGCCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113605756_1113605762 5 Left 1113605756 13:111604212-111604234 CCTTCTCGGCGATGCCACCGCGT 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605754_1113605762 14 Left 1113605754 13:111604203-111604225 CCTCTCATCCCTTCTCGGCGATG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605758_1113605762 -9 Left 1113605758 13:111604226-111604248 CCACCGCGTCCTCCTGGACTGAT 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605753_1113605762 15 Left 1113605753 13:111604202-111604224 CCCTCTCATCCCTTCTCGGCGAT 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186
1113605755_1113605762 6 Left 1113605755 13:111604211-111604233 CCCTTCTCGGCGATGCCACCGCG 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113605762 Original CRISPR TGGACTGATGCTGCCTCTTC TGG Intronic