ID: 1113606394

View in Genome Browser
Species Human (GRCh38)
Location 13:111610657-111610679
Sequence AGGGTGGCCCTCAGCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113606385_1113606394 14 Left 1113606385 13:111610620-111610642 CCTACCCTGAAGCCAGGTACTGC 0: 1
1: 0
2: 4
3: 29
4: 244
Right 1113606394 13:111610657-111610679 AGGGTGGCCCTCAGCTCCCATGG 0: 1
1: 0
2: 0
3: 22
4: 274
1113606386_1113606394 10 Left 1113606386 13:111610624-111610646 CCCTGAAGCCAGGTACTGCTCCT 0: 1
1: 0
2: 2
3: 18
4: 218
Right 1113606394 13:111610657-111610679 AGGGTGGCCCTCAGCTCCCATGG 0: 1
1: 0
2: 0
3: 22
4: 274
1113606393_1113606394 -10 Left 1113606393 13:111610644-111610666 CCTGGAAGAGCTCAGGGTGGCCC 0: 1
1: 0
2: 5
3: 33
4: 275
Right 1113606394 13:111610657-111610679 AGGGTGGCCCTCAGCTCCCATGG 0: 1
1: 0
2: 0
3: 22
4: 274
1113606389_1113606394 2 Left 1113606389 13:111610632-111610654 CCAGGTACTGCTCCTGGAAGAGC 0: 1
1: 0
2: 0
3: 22
4: 221
Right 1113606394 13:111610657-111610679 AGGGTGGCCCTCAGCTCCCATGG 0: 1
1: 0
2: 0
3: 22
4: 274
1113606387_1113606394 9 Left 1113606387 13:111610625-111610647 CCTGAAGCCAGGTACTGCTCCTG 0: 1
1: 0
2: 1
3: 11
4: 224
Right 1113606394 13:111610657-111610679 AGGGTGGCCCTCAGCTCCCATGG 0: 1
1: 0
2: 0
3: 22
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113606394 Original CRISPR AGGGTGGCCCTCAGCTCCCA TGG Intronic