ID: 1113607489

View in Genome Browser
Species Human (GRCh38)
Location 13:111620736-111620758
Sequence TTCCCACAGCCCCCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113607489_1113607492 -9 Left 1113607489 13:111620736-111620758 CCTCTCCTGGGGGGCTGTGGGAA 0: 1
1: 0
2: 3
3: 42
4: 292
Right 1113607492 13:111620750-111620772 CTGTGGGAATGCCTGGCTGCAGG 0: 1
1: 0
2: 2
3: 26
4: 301
1113607489_1113607498 19 Left 1113607489 13:111620736-111620758 CCTCTCCTGGGGGGCTGTGGGAA 0: 1
1: 0
2: 3
3: 42
4: 292
Right 1113607498 13:111620778-111620800 CCACGGAGGAGCTTTGACACTGG 0: 1
1: 0
2: 0
3: 8
4: 81
1113607489_1113607494 2 Left 1113607489 13:111620736-111620758 CCTCTCCTGGGGGGCTGTGGGAA 0: 1
1: 0
2: 3
3: 42
4: 292
Right 1113607494 13:111620761-111620783 CCTGGCTGCAGGTCAGCCCACGG 0: 1
1: 0
2: 2
3: 38
4: 282
1113607489_1113607495 5 Left 1113607489 13:111620736-111620758 CCTCTCCTGGGGGGCTGTGGGAA 0: 1
1: 0
2: 3
3: 42
4: 292
Right 1113607495 13:111620764-111620786 GGCTGCAGGTCAGCCCACGGAGG 0: 1
1: 0
2: 0
3: 22
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113607489 Original CRISPR TTCCCACAGCCCCCCAGGAG AGG (reversed) Intronic
900311472 1:2035511-2035533 TGCCCACAGCCCACCAGCTGGGG + Intergenic
900358659 1:2277048-2277070 TTCCTACAGCCCCAAATGAGAGG - Intronic
900418306 1:2545067-2545089 TTCCCACAGCCCCACAGAAAGGG + Intergenic
900610249 1:3541676-3541698 TTCCCACTGTCCCCAGGGAGAGG - Intronic
901229583 1:7634347-7634369 TTCCCACAGCTGCCCAGGTCTGG - Intronic
902705191 1:18199619-18199641 TTACCGCAGCCACCGAGGAGAGG - Intronic
903373803 1:22853425-22853447 TGCTCACAGCCTCCTAGGAGAGG + Intronic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
904160485 1:28518866-28518888 GTCCCCCAGCCCCGCAAGAGAGG - Intronic
904360764 1:29970333-29970355 TTCACAAAGCACCCCAGGAGGGG - Intergenic
904682573 1:32239818-32239840 TTCACAGAGCCCTGCAGGAGAGG + Intergenic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
905915227 1:41679740-41679762 TTCCCACATCCTCCCAGGTCTGG - Intronic
905926348 1:41752504-41752526 TTCCCTCAGCCCCCTAGGCTGGG - Intronic
907396090 1:54190965-54190987 TTCCCACTGTCCCCAAGGAGAGG + Intronic
907405204 1:54249822-54249844 TTCCAACAGCCCTCCAGGTCAGG + Intronic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
909358075 1:74732138-74732160 TTCCCACAGCCCAGCTGTAGGGG - Intronic
909358151 1:74732437-74732459 TTCCCACAGCCCAGCTGTAGGGG - Intronic
911180292 1:94854555-94854577 TTCACACAGCCATCCAGGAGAGG + Intronic
912855503 1:113165573-113165595 TTCCCACTTCCTCCCAGGAAGGG + Intergenic
915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG + Intergenic
915595053 1:156892406-156892428 TTCCCAGAGCCCCACAGCCGGGG - Intergenic
916863944 1:168836462-168836484 TTCCCACAGCCACCAAGGAAAGG + Intergenic
917525696 1:175786514-175786536 TTCCCACAGCACCCCACTAGAGG + Intergenic
919897416 1:202017993-202018015 TGCCCCCAGCCCTCCAGAAGAGG - Intergenic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
922039701 1:221884728-221884750 TTCCCAAAGCCACTCAGCAGGGG - Intergenic
922161296 1:223080686-223080708 CTCACACAGGCCCACAGGAGAGG + Intergenic
922350898 1:224733899-224733921 TGGCCACAGCCCCTGAGGAGGGG - Intronic
922728750 1:227939332-227939354 ATTCCCCAGCCCCACAGGAGTGG + Intronic
922987061 1:229874121-229874143 CTATCACAGCCCCACAGGAGAGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923567662 1:235088653-235088675 TTTTCACAGCCTCCCAGGCGAGG - Intergenic
924427206 1:243962764-243962786 ATCCCACAGCCCTCCTGGTGGGG - Intergenic
1064031704 10:11887047-11887069 TCCCGAAAGCCCCGCAGGAGGGG + Intergenic
1064400275 10:15015208-15015230 TACCCACAGTCCTCCAGGTGTGG + Intergenic
1068252104 10:54456070-54456092 TTTCCACATTTCCCCAGGAGAGG - Intronic
1069636892 10:69930438-69930460 TCCCCAAGGCCCCCCAGGAAAGG + Exonic
1069867318 10:71511843-71511865 TGCCATCAGCCACCCAGGAGAGG - Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1069984259 10:72273198-72273220 TTCCAACTGCTCCCAAGGAGAGG - Intergenic
1073485923 10:103819266-103819288 TTCCCAGGGAACCCCAGGAGAGG + Intronic
1073570363 10:104576196-104576218 TTCCCACAGCCTTCCAGGCGGGG + Intergenic
1074188797 10:111118026-111118048 TGCCAACTGTCCCCCAGGAGTGG + Intergenic
1074365766 10:112856337-112856359 TTCCCACCTCCACCCTGGAGAGG + Intergenic
1074579443 10:114704681-114704703 ACCCCACAGCCTCCCAGGAAGGG - Intergenic
1075311635 10:121419174-121419196 TTCCCACAGCCTCCCAAATGAGG + Intergenic
1075335226 10:121604032-121604054 TGCCCACTGCTCCCCAGCAGCGG + Intergenic
1075954750 10:126513315-126513337 TTCCCATAGCCCCACAAGACAGG - Intronic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076698612 10:132258741-132258763 TTCCCACTGCCCCTCCTGAGCGG + Intronic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077170205 11:1162703-1162725 CTCCCACAGCCTCTCCGGAGAGG + Intronic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1078550581 11:12277468-12277490 TTCCCACAGCCTCCCAGAGGAGG + Intronic
1078916510 11:15783678-15783700 TTCCCTCAGGCCCTCAGGTGCGG - Intergenic
1079882551 11:25944826-25944848 TTCCCACATGCCCCCAGGATAGG + Intergenic
1083325960 11:61873139-61873161 CTCCCACAGCCCTCCATGATGGG - Intergenic
1083949773 11:65947525-65947547 CTGCCCCAGCGCCCCAGGAGGGG + Exonic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084041745 11:66546672-66546694 GTCACACAGCGCCCCAGCAGCGG + Exonic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1085519978 11:77132002-77132024 TTCCCACAGCTGCCGATGAGAGG + Intronic
1086662562 11:89438109-89438131 TTCCCAGAGGTCCCCATGAGTGG - Intronic
1086958041 11:92954113-92954135 TTCCTACAGGCCTCCAGAAGTGG + Intergenic
1087013524 11:93534928-93534950 TTCCCATAGCAAGCCAGGAGAGG + Intronic
1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG + Intronic
1090146969 11:124335384-124335406 TTCCTAGAGCCTCCAAGGAGAGG + Intergenic
1090666214 11:128916621-128916643 TCAGCACAGCCCCCCAGCAGTGG - Exonic
1090925000 11:131241691-131241713 TTTCCACAGTCCCCCAGTCGGGG - Intergenic
1091131212 11:133148671-133148693 ATCCCACCGCCCTCCAGGGGAGG + Intronic
1091331731 11:134736184-134736206 TTCCCACGGGCCCCCAGGAATGG - Intergenic
1091754664 12:3043646-3043668 TTCCCCCAGACCCCCAGGGCTGG - Intergenic
1091848556 12:3677115-3677137 CTCCCATATCCTCCCAGGAGGGG - Intronic
1092117938 12:6022734-6022756 TGCCCACTGCCCTCCAGGTGAGG - Exonic
1092242451 12:6843547-6843569 TTCCCTGAACCCCTCAGGAGGGG - Intronic
1092682011 12:10993858-10993880 TTCTCACAAGCCCACAGGAGAGG + Intronic
1093027115 12:14255222-14255244 GTCCCACTGCCCCTCAGAAGAGG - Intergenic
1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG + Intergenic
1097118384 12:56716052-56716074 TTCCAACACCAGCCCAGGAGAGG + Exonic
1100378292 12:94038116-94038138 ATCCCACAGCTCCCAAGTAGTGG + Intergenic
1100433023 12:94547246-94547268 TTCTCACAGGCCCCCAGGTGGGG + Intergenic
1102031692 12:109743577-109743599 TCCTCATAGCCCCCCTGGAGGGG - Intronic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103915952 12:124375867-124375889 TTTCCACTGCCCCCGGGGAGGGG + Intronic
1104924314 12:132306072-132306094 TCCCCACAGGCTCCCAGGTGAGG - Intronic
1104948761 12:132429338-132429360 TTCCCACAGGCCCCATGGAAAGG - Intergenic
1105300372 13:19128492-19128514 TCCCCACCGCCCCCCACCAGTGG - Intergenic
1108106353 13:47014701-47014723 TTGCCACAGTGCCCCAGGACTGG + Intergenic
1110119834 13:71866816-71866838 TTGCCACACACCCCCGGGAGGGG + Intronic
1111270244 13:85872395-85872417 TTCTCACACCCCACCAGGACTGG + Intergenic
1112264020 13:97906078-97906100 TTGCTAGAGCCTCCCAGGAGAGG - Intergenic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113853463 13:113431084-113431106 GGCCCACAGCCACCTAGGAGAGG + Intronic
1116147958 14:41099746-41099768 TTCCCACAGTGCCCTAGCAGAGG - Intergenic
1118037739 14:61886252-61886274 TTGCCACAGCCAGCCAGGTGCGG - Intergenic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1121422530 14:93825265-93825287 TTCCACCACCCCCCCGGGAGCGG - Intergenic
1122746504 14:103900061-103900083 TGCCCACATCCGCCCAGGTGGGG + Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1123630432 15:22257123-22257145 TTCGCACAAACCCCCGGGAGCGG + Intergenic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1124800618 15:32829407-32829429 ATAACACAGGCCCCCAGGAGAGG + Intronic
1125439108 15:39682493-39682515 TTCTCACTGCTCCCCAGGAAGGG + Intronic
1127799067 15:62462319-62462341 TTCACAGAAGCCCCCAGGAGAGG + Intronic
1128577168 15:68784038-68784060 TTTCCAAAGCCCCCAGGGAGTGG - Intronic
1128737631 15:70062200-70062222 TCCCCACAGCCGTGCAGGAGCGG + Intronic
1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG + Intergenic
1129677830 15:77642016-77642038 TTCCCACAACCCTCCAAGATAGG - Intronic
1129772204 15:78209410-78209432 TTTCCACAACCTCCCTGGAGTGG - Intronic
1130132168 15:81153295-81153317 TCCCCACTTCTCCCCAGGAGAGG - Intergenic
1130388526 15:83434416-83434438 CTCACACATCCCCCCAGGAGGGG - Intergenic
1130975302 15:88769235-88769257 TCTGCACAGCCCCCCAGGAGGGG - Intergenic
1131530935 15:93191137-93191159 TTCCCAGAGCCCCCCAGCAATGG + Intergenic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG + Intronic
1132598655 16:764374-764396 TGCCCACGGCGCTCCAGGAGGGG - Intronic
1132691351 16:1183176-1183198 TTCCCACAGCCGCACGGGGGTGG - Intronic
1133980594 16:10630486-10630508 CTCCCTCCGCCTCCCAGGAGAGG + Intronic
1136316563 16:29457914-29457936 TTCTCACAGCTACCAAGGAGAGG - Exonic
1136431139 16:30197256-30197278 TTCTCACAGCTACCAAGGAGAGG - Exonic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137385546 16:48039249-48039271 TTCCTACAGACCCCCAGGAAGGG + Intergenic
1137547083 16:49411736-49411758 TCCCCACAGGGCCCCAGCAGTGG + Intergenic
1137729240 16:50677621-50677643 TTCCCTCTGCCTGCCAGGAGGGG - Intronic
1138405304 16:56788199-56788221 TTCCCCTACCCTCCCAGGAGAGG + Intronic
1141183308 16:81769458-81769480 TTTCTAAGGCCCCCCAGGAGAGG + Intronic
1141219071 16:82052187-82052209 TTCCCACAGCCCACCAAGGAAGG - Intronic
1141947343 16:87319776-87319798 TTTCCAAAGCCCCCAAGTAGAGG + Intronic
1142189494 16:88711345-88711367 TCCCAACAACGCCCCAGGAGAGG - Intronic
1142380426 16:89728960-89728982 TTTCCACAGCGGCCCAGAAGGGG - Intronic
1143411766 17:6713485-6713507 GTCCCACAGACCCCGAGGGGTGG - Exonic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1143953047 17:10648594-10648616 TTCCCAAAGGCCTCCAGCAGGGG + Exonic
1147686428 17:42289058-42289080 GGCCCACAGGCCCCCTGGAGAGG - Intronic
1148028624 17:44605132-44605154 TTCCCAATGCCCTCCAGAAGAGG - Intergenic
1148189943 17:45671529-45671551 TTGCCACTGCCCCACAGCAGGGG - Intergenic
1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG + Intergenic
1148806297 17:50265644-50265666 TCCCCAAGGCCCCCCAGGGGAGG + Intergenic
1150128425 17:62653313-62653335 TTCCCAGAGAACCCCAGGGGCGG + Intronic
1150712562 17:67544376-67544398 TTCCCACTGAAGCCCAGGAGGGG + Intronic
1151657569 17:75502884-75502906 ATCCCAGCCCCCCCCAGGAGAGG - Exonic
1152179169 17:78807146-78807168 GCCCCCCAGACCCCCAGGAGTGG - Exonic
1154411511 18:14144493-14144515 CTCCCACTGACCCCAAGGAGGGG + Intergenic
1155158525 18:23177671-23177693 TTCCCAGAGCCCAACAGGACAGG - Intronic
1157528965 18:48406183-48406205 TTCCCACAGCCTGCTATGAGAGG + Intronic
1157967264 18:52222360-52222382 TTTCCAGAGCCCCACAGGAATGG - Intergenic
1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG + Intergenic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161628091 19:5338554-5338576 ATCCCACAGCCCCCCAGCTTGGG - Intronic
1163106011 19:15123452-15123474 TTCTCACAGGCCACCAGCAGCGG + Exonic
1163709474 19:18837774-18837796 CTCCCACAGGCTACCAGGAGTGG - Intronic
1164679465 19:30124083-30124105 TCCCCACACCCCCGCTGGAGGGG - Intergenic
1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG + Intergenic
1165315836 19:35054874-35054896 TTCCCACAGCCCCGCAGGTTGGG - Intronic
1165705931 19:37976209-37976231 TGCCCACGGCGCCCCAGGGGAGG + Intronic
1165866394 19:38942091-38942113 CTTCCTCAGCCCCCCAGAAGGGG - Exonic
1166404885 19:42513191-42513213 TTCCCACAGGCTCCCAGCAGGGG + Intronic
1166424837 19:42668508-42668530 TTCCCAGGGCCTCCCAGCAGGGG - Intronic
1166443724 19:42839831-42839853 TTCCTACAGGCTCCCAGGAAGGG + Intronic
1166451171 19:42902513-42902535 TTCCCACAGGCTCCCAGCAAGGG + Intronic
1166463417 19:43010494-43010516 TTCCTACAGGCTCCCAGGAAGGG + Intronic
1166480695 19:43170593-43170615 TTCCCACAGGCTCCCAGGAAGGG + Intronic
1166490280 19:43253713-43253735 TTCCTACAGGCTCCCAGGAAGGG + Intronic
1167166471 19:47802975-47802997 TCCCCTCTGCCCCCCAGGTGTGG - Exonic
1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG + Intergenic
1168126649 19:54287013-54287035 TTCCCCCAGCCCCGCAGGGAGGG - Intergenic
1168233472 19:55047529-55047551 CTGCCACAGCCTCCCAGGTGAGG - Intronic
925201035 2:1967970-1967992 TGCTCACTGCACCCCAGGAGGGG + Intronic
925867803 2:8244337-8244359 TTCCCAGAGCCCCCATGGTGAGG - Intergenic
927251704 2:21000486-21000508 TTCACTCAGCCTGCCAGGAGTGG - Intergenic
927694578 2:25231193-25231215 CTCCCCCAGCCCTCCTGGAGTGG + Exonic
927695494 2:25236893-25236915 TTCTCCCTGCCCCCCAGCAGAGG + Intronic
927756837 2:25715426-25715448 TTCCCACAGCCCCCCCAAACTGG - Intergenic
928420056 2:31131442-31131464 TTCACAGACTCCCCCAGGAGAGG + Intronic
928493843 2:31811830-31811852 ATGCCACAGCCCCACAGGAGAGG - Intergenic
929281853 2:40088263-40088285 CTCCCTCATCCCCCCAGCAGTGG - Intergenic
932417238 2:71580762-71580784 TTCCTACTGCCCCTCAGTAGGGG + Intronic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
933637239 2:84721427-84721449 TTACCCCAGCCCACCAGGAAAGG - Intronic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
933897575 2:86825303-86825325 CCCCCATAGCCCCCCAGTAGGGG - Intronic
935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG + Intergenic
935274435 2:101463781-101463803 CTCCCACAGCTCACCAGGTGTGG - Intronic
935552675 2:104474946-104474968 TTCCAACAGTCCACCTGGAGAGG + Intergenic
937872782 2:126797977-126797999 TCCCCAGAGCCCCTCAGGTGAGG + Intergenic
940581281 2:155584125-155584147 TTCTCACATGCCCCCAGGAAAGG + Intergenic
941081648 2:161068297-161068319 TTCCCAGAGCAGCACAGGAGGGG - Intergenic
946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG + Intergenic
947712902 2:232326049-232326071 CTAGCACAGCTCCCCAGGAGAGG + Intronic
947736307 2:232457255-232457277 CTGCCTCAGCCCGCCAGGAGGGG + Exonic
947863858 2:233382334-233382356 TTCACAAAGCCCCCCAAAAGTGG - Intronic
1170191967 20:13653154-13653176 ATCCCACAGACTCCTAGGAGGGG + Intergenic
1170352719 20:15459711-15459733 TTCCCATAGGCTCCCGGGAGAGG - Intronic
1170808316 20:19653638-19653660 GTCTCACATCCCCCCAGGAACGG - Intronic
1170889323 20:20365223-20365245 TTCGCGAAGCCCCCCTGGAGGGG + Intergenic
1171210301 20:23311222-23311244 TTCCCACAGAGCCCGGGGAGGGG + Intergenic
1171382494 20:24744117-24744139 ATCCCACAGCCCAGGAGGAGGGG - Intergenic
1172626056 20:36347491-36347513 TTTCCACAGCACCCCAGCACAGG - Intronic
1172903159 20:38349539-38349561 TTTCCACAGCGGCCCAGGAGGGG + Exonic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1173586467 20:44186811-44186833 TCACCACTGCACCCCAGGAGGGG + Exonic
1173681505 20:44885602-44885624 TTGCCACGGCCCCACGGGAGGGG - Intergenic
1175342166 20:58239731-58239753 TGCCTACAGCCTCCCAGGGGTGG - Intergenic
1175381844 20:58569005-58569027 TTCCTTCTGCCACCCAGGAGAGG + Intergenic
1176026239 20:62986971-62986993 GGCCCACAGACACCCAGGAGGGG - Intergenic
1176171350 20:63697736-63697758 TTCCCAGAGCTCCCCAGGGGAGG - Intronic
1176288652 21:5032994-5033016 TTCCCAGAACCCCCCAAGGGTGG + Intronic
1176861546 21:14013931-14013953 CTCCCACTGACCCCAAGGAGGGG - Intergenic
1178697503 21:34807317-34807339 TTCCAACAGCACCCCTTGAGCGG + Intronic
1179047639 21:37860701-37860723 CTCCCACTACCCCCCTGGAGTGG + Intronic
1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG + Intronic
1179518921 21:41929431-41929453 TTCCCACAGCCCTGCACGGGAGG + Intronic
1179712081 21:43269120-43269142 TGACCACAGCCCCCCACCAGAGG - Intergenic
1179807878 21:43851540-43851562 CTCCAACAGCCCCCCTGGATGGG - Intergenic
1179868532 21:44230481-44230503 TTCCCAGAACCCCCCAAGGGTGG - Intronic
1179878520 21:44283770-44283792 TCCCCACAGCCTCAAAGGAGAGG + Intergenic
1179990553 21:44946401-44946423 TTCCCATAGCCCGCCTTGAGGGG + Intronic
1180569373 22:16701148-16701170 TGCCCACTGCCCTCCAGGTGAGG - Intergenic
1180844338 22:18973154-18973176 GTTCCACAGACCCCCAGGTGAGG - Intergenic
1181057133 22:20265557-20265579 GTTCCACAGACCCCCAGGTGAGG + Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181581673 22:23832219-23832241 TTCTCACAGCCTCCCTGTAGTGG - Intronic
1181913841 22:26263162-26263184 TTTCCACAACCACCCAAGAGGGG + Intronic
1182211213 22:28679294-28679316 TTCCCCCAGCCCCCGTGGGGCGG - Intronic
1183016937 22:34996579-34996601 TGCCCACAGCCCATCAGGAATGG + Intergenic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
1184288966 22:43488083-43488105 TCCTCACACCCCCCCAAGAGAGG - Intronic
1185366695 22:50440114-50440136 CTCCCACTGCCCCCAAGGAGGGG - Intronic
951703075 3:25515500-25515522 TTCCCCCTCCCCCCCAGGATTGG - Intronic
952863581 3:37835163-37835185 TTCCCACCCCCCCCCACCAGTGG - Intergenic
952937585 3:38412343-38412365 TTCACACAGCTGTCCAGGAGAGG - Intronic
953058476 3:39406940-39406962 TTCCCAGAGTGCCCCGGGAGCGG + Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG + Intronic
961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG + Intronic
961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG + Intergenic
966772595 3:183517414-183517436 GTCTCACAGTCCCCCAGGAGGGG + Intronic
967989961 3:195123351-195123373 TTCCGTCAGCCGGCCAGGAGAGG - Intronic
968502472 4:957329-957351 TTCCCACAGCCTCCCTGTGGAGG + Intronic
968579586 4:1383690-1383712 TTACCCGAGGCCCCCAGGAGGGG - Intronic
968647768 4:1748911-1748933 TGGCCACAGGCCTCCAGGAGGGG + Intergenic
968662927 4:1806240-1806262 TTCCCACACCCTCCCAGGGCCGG + Exonic
969054134 4:4391015-4391037 TGTCCACAGCCCTCCAGGACTGG - Intronic
969146158 4:5125848-5125870 CTCCCACAGACCCCCACGAAGGG + Intronic
971522185 4:27567994-27568016 TTCCCAGTGCCACCCAGAAGTGG - Intergenic
981663185 4:147191074-147191096 CTCCCACATCCCTCCAGGATGGG + Intergenic
982388601 4:154839262-154839284 TTCCCTCAGCCCCCCATCACTGG - Intergenic
984063137 4:175017018-175017040 AGACCACAGCCCCCCAGAAGTGG + Intergenic
984108039 4:175574790-175574812 ACACCACAGCCCCCCAGAAGTGG + Intergenic
985283362 4:188308855-188308877 TTCCTACAGCCTCACAGGATGGG + Intergenic
985631257 5:1015255-1015277 TGCCCACAGCCTCCCTGGCGTGG + Intronic
990368107 5:55090171-55090193 TGCCCAAAGCCCCACTGGAGCGG - Intergenic
992213783 5:74506233-74506255 TTTGCTCAGCCCCCCAGGGGAGG - Intergenic
992433529 5:76732855-76732877 TTCCCAGAGTACGCCAGGAGAGG - Exonic
993454918 5:88116608-88116630 TTCCCACAGCCTCCAGGTAGAGG - Intergenic
993836256 5:92823665-92823687 TTCCCACAGCCCCCACTGACAGG + Intergenic
995740452 5:115350456-115350478 CTGCCACAGCCACCAAGGAGAGG + Intergenic
997453737 5:134003349-134003371 TTCCCCTATCTCCCCAGGAGAGG + Intronic
998411876 5:141917381-141917403 TTCCCCAAGCCACCCAGGAAAGG - Intergenic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
1000795143 5:165655874-165655896 TTCCCACAGTCTCCCGGCAGGGG - Intergenic
1000893533 5:166827573-166827595 TTTCCAAAGTCCCCCAGAAGTGG + Intergenic
1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG + Intronic
1002399028 5:178981002-178981024 TTCCCCCATCCCCCCGGGATTGG - Exonic
1003942929 6:11045539-11045561 CTCCCACACCGCCCCAGGTGTGG - Intergenic
1005586416 6:27280556-27280578 TTTACACAGCCCCCCAGTAGAGG + Intergenic
1008639367 6:53445806-53445828 TTCCCACAGTCTCCCAGGACTGG - Intergenic
1010610811 6:77952154-77952176 TTCTCACAGCTCCACAAGAGGGG - Intergenic
1013367403 6:109446344-109446366 CTCCCACAGCCTCGCAGGAGGGG - Exonic
1014652201 6:124053542-124053564 TTCTGGCAGCCCCCAAGGAGAGG + Intronic
1016045175 6:139473527-139473549 TTGCAAGAGCCCTCCAGGAGAGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018369748 6:163156727-163156749 TTCCAGCAGAGCCCCAGGAGGGG - Intronic
1019378954 7:711718-711740 TCCCCACAGACCCCCGGCAGGGG + Intronic
1019707874 7:2505053-2505075 TTCCCACCGCCTCCCCGCAGAGG + Intergenic
1020268438 7:6577505-6577527 TTCCCACAGCCCCGCGGAGGCGG - Exonic
1020697813 7:11437130-11437152 TTCCCAGAGCCCCTCAGGCCAGG - Intronic
1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG + Intronic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1023267705 7:38425290-38425312 AGCCCACAGCAGCCCAGGAGAGG + Intronic
1026878803 7:73895079-73895101 TCCCCACAACCCCCAGGGAGGGG + Intergenic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1034443730 7:151101231-151101253 TTCCCCCACCAGCCCAGGAGGGG - Intronic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1035062401 7:156079321-156079343 TTCCCACAGGCTCCCTGGATGGG + Intergenic
1035068277 7:156123388-156123410 CTCCCTCCGCCTCCCAGGAGTGG + Intergenic
1035595322 8:853293-853315 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1035604390 8:920122-920144 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1035735155 8:1882220-1882242 TTCCCACTGCACCCCATGTGGGG - Intronic
1036262209 8:7249893-7249915 TACCCACAGTCCTCCAGGTGCGG + Intergenic
1036304379 8:7589665-7589687 TACCCACAGTCCTCCAGGTGCGG - Intergenic
1036314248 8:7708432-7708454 TACCCACAGTCCTCCAGGTGCGG + Intergenic
1036355231 8:8037657-8037679 TACCCACAGTCCTCCAGGTGCGG - Intergenic
1036822877 8:11954104-11954126 TTCTCAAAGCTCCCCAAGAGGGG - Intergenic
1036831288 8:12022424-12022446 TTCCCAGTGCCCACCAGGAATGG + Intergenic
1037302706 8:17469592-17469614 ATACCACAGCCCCCCAGAAGTGG + Intergenic
1039598189 8:38809682-38809704 GTCCCACAGCCCCCAAAGAAAGG - Intronic
1039788624 8:40856089-40856111 TTCACACAGGCCCACAGGACAGG + Intronic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1040907201 8:52480895-52480917 TTCCTCCAGTCCCCCAGGAGAGG + Intergenic
1040947133 8:52895276-52895298 TACTCACAGCCGCCCCGGAGTGG - Intergenic
1042449022 8:68922957-68922979 ATCCCACAGGCCCCTAAGAGGGG - Intergenic
1045278531 8:100728408-100728430 TTGCCTCAGCCTCCCAGTAGTGG - Intergenic
1048379486 8:133852464-133852486 TTCTCACAGCCCCTCACCAGGGG + Intergenic
1048847012 8:138611471-138611493 GCTCCAGAGCCCCCCAGGAGTGG - Intronic
1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG + Intronic
1049318002 8:141979868-141979890 TTGCCACAGCCCTGGAGGAGGGG - Intergenic
1049475594 8:142795664-142795686 TTCCCACAGCCGCCCTGGTCCGG - Intergenic
1053222342 9:36322870-36322892 TTCCCACAGTGCACCAGGATTGG + Intergenic
1054825978 9:69573773-69573795 TTTCCACAGGACCCCAGCAGAGG - Intronic
1056766292 9:89446654-89446676 TTCCCACTTCCCCTCAGCAGGGG + Intronic
1056811835 9:89771133-89771155 TTCTCACAGCCACCCAGGAGAGG - Intergenic
1057786695 9:98093404-98093426 TCCTCACAGCAGCCCAGGAGAGG + Intronic
1057818181 9:98311150-98311172 TTCTCACAGTGCTCCAGGAGAGG + Exonic
1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG + Intronic
1058439453 9:104993525-104993547 TTTCCAAAGCCTCCTAGGAGAGG - Intergenic
1058973194 9:110101671-110101693 TTCCCACGGCCTCTCTGGAGGGG + Intronic
1061296671 9:129680565-129680587 TTCCCCAAGCCCCACAGGAAGGG + Intronic
1062408342 9:136408787-136408809 TGGCCCCAGCCCCCCAGGTGGGG + Intronic
1062423079 9:136493445-136493467 TTCGGACAGACCCCCAGGAGTGG + Intergenic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189173882 X:38934894-38934916 TTCTCACAGCCCCACACAAGTGG - Intergenic
1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG + Intergenic
1189363412 X:40370400-40370422 GCCCCACAGCCACCAAGGAGGGG - Intergenic
1189772416 X:44439404-44439426 TTCCCCCAGCTCCCCAGAGGAGG - Intergenic
1195328061 X:103774208-103774230 TTCCCACAGGCACCCAGTACAGG + Intronic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1196691032 X:118558261-118558283 TTCACACAGGCGGCCAGGAGCGG - Intronic
1201773097 Y:17637462-17637484 CTCACACAGTCACCCAGGAGTGG + Intergenic
1201828458 Y:18268524-18268546 CTCACACAGTCACCCAGGAGTGG - Intergenic