ID: 1113610677

View in Genome Browser
Species Human (GRCh38)
Location 13:111642742-111642764
Sequence CTCACGCACGTGTGCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113610677_1113610685 26 Left 1113610677 13:111642742-111642764 CCAGGTGTGCACACGTGCGTGAG 0: 1
1: 0
2: 1
3: 3
4: 89
Right 1113610685 13:111642791-111642813 CTTTTACAGATCTGTGAAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 341
1113610677_1113610684 25 Left 1113610677 13:111642742-111642764 CCAGGTGTGCACACGTGCGTGAG 0: 1
1: 0
2: 1
3: 3
4: 89
Right 1113610684 13:111642790-111642812 ACTTTTACAGATCTGTGAAGTGG 0: 1
1: 0
2: 0
3: 16
4: 231
1113610677_1113610686 27 Left 1113610677 13:111642742-111642764 CCAGGTGTGCACACGTGCGTGAG 0: 1
1: 0
2: 1
3: 3
4: 89
Right 1113610686 13:111642792-111642814 TTTTACAGATCTGTGAAGTGGGG 0: 1
1: 0
2: 7
3: 95
4: 1245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113610677 Original CRISPR CTCACGCACGTGTGCACACC TGG (reversed) Intronic
903798824 1:25951300-25951322 CTTACACACATGTACACACCTGG + Intergenic
906522993 1:46478195-46478217 CACACACACCTGTGCACACACGG - Intergenic
906705327 1:47890577-47890599 CTCAGTCACCTGTGGACACCTGG - Intronic
915024971 1:152819033-152819055 CACACGCACGCATGCACACATGG + Intergenic
915038931 1:152951466-152951488 TCCATGCACATGTGCACACCTGG - Intergenic
916414175 1:164576987-164577009 CTCACCCACGTGCTCACACGCGG - Intronic
920346151 1:205306929-205306951 CTCATTCCTGTGTGCACACCGGG + Intronic
924381577 1:243470298-243470320 ATCACTCACATGTGCTCACCAGG + Intronic
1062816867 10:507220-507242 CTCACGCCTCTGTGCACAGCGGG - Intronic
1066055745 10:31678515-31678537 CTCACAAACATGTGCCCACCTGG - Intergenic
1073597880 10:104818085-104818107 CACACACACCTGTGCACACTTGG + Intronic
1075415402 10:122258817-122258839 CTCATGCACGTGTTCACCCTCGG + Intergenic
1076803695 10:132844725-132844747 CTCCCGCACGGCTGCAGACCAGG - Intronic
1076809698 10:132880086-132880108 CACACACACGTGCGCACAGCAGG - Intronic
1077373416 11:2194150-2194172 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373420 11:2194192-2194214 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373425 11:2194234-2194256 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373430 11:2194276-2194298 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373435 11:2194318-2194340 CTCTCACATGTGTGCACACAGGG - Intergenic
1077409362 11:2396230-2396252 CACACCCACGAGTGCACACGTGG - Intronic
1079668538 11:23136378-23136400 CTCAAGCATGTGTGGAGACCTGG - Intergenic
1085817694 11:79758000-79758022 CACATGCATGTGTGCACACATGG + Intergenic
1089203270 11:116738511-116738533 CCCACCCACGTGCACACACCAGG - Intergenic
1097165934 12:57087007-57087029 CTCACACACGGGTTCGCACCCGG + Intronic
1098913777 12:76236758-76236780 CTCAGGCATGTGGCCACACCTGG + Intergenic
1102650431 12:114438474-114438496 ATCATGCACGTGAGCATACCAGG - Intergenic
1106586177 13:31058279-31058301 CACACACACGTGTGCACACCAGG - Intergenic
1107674467 13:42780261-42780283 CTCAGGAACCTGTGCTCACCAGG - Intergenic
1112197637 13:97241687-97241709 CACACGCACGTGTGCAACACAGG + Intronic
1113610677 13:111642742-111642764 CTCACGCACGTGTGCACACCTGG - Intronic
1117545782 14:56794283-56794305 CTCGCGGAAGTGTGCCCACCCGG - Intergenic
1120508838 14:85387518-85387540 CACATGCACATATGCACACCAGG - Intergenic
1121010483 14:90517403-90517425 CATACGCAGGTGTGAACACCTGG + Intergenic
1121532426 14:94664905-94664927 CACACACACATGTACACACCCGG + Intergenic
1127585835 15:60376953-60376975 CACACACACGTGTGTACACACGG + Intronic
1130423894 15:83775940-83775962 CTCATGCACGTGCCCACATCTGG + Intronic
1132467555 16:84479-84501 CTGATGCACCTGTGCACCCCTGG - Intronic
1133489990 16:6258430-6258452 CTCATGCTCATGTGCACACACGG - Intronic
1135765406 16:25173507-25173529 GACACACACGTGTTCACACCTGG + Intronic
1141572223 16:84941071-84941093 CTCACGCACATGATCACACACGG - Intergenic
1147369319 17:39980868-39980890 CTCGCGCTCGTGTGCAGGCCCGG + Exonic
1148130980 17:45262466-45262488 CACACACACTTGTGCACACAGGG + Intergenic
1150585634 17:66515358-66515380 TACACACACGTGTGCACACATGG - Intronic
1151174958 17:72280307-72280329 CTCATGCACATGTGCACACTGGG + Intergenic
1152468299 17:80477501-80477523 CCCACGCACAGGTGGACACCCGG - Intronic
1152552967 17:81038988-81039010 TGCATGCACGTGTGCACACACGG - Intronic
1152575751 17:81140218-81140240 CTCACGGCAGAGTGCACACCAGG - Intronic
1152880268 17:82810609-82810631 CTCACACGTGTGAGCACACCAGG - Intronic
1158872734 18:61704247-61704269 AACACTCACGTGTGCACACATGG + Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161394236 19:4037020-4037042 CTCAAACATGCGTGCACACCCGG + Intronic
1162746523 19:12801726-12801748 CCCACGCAGGTATGAACACCCGG - Exonic
1163598198 19:18232725-18232747 CAACCGCACGTGGGCACACCCGG + Intronic
1164479691 19:28601949-28601971 CACACGCACATGCACACACCTGG + Intergenic
1165417621 19:35704492-35704514 CTCCCGCACGTGGTCACCCCTGG - Intergenic
935300102 2:101686518-101686540 CACACGCACGTACACACACCAGG - Intergenic
937233226 2:120414312-120414334 CCCACGCACCTGTCAACACCTGG - Intergenic
938105434 2:128526792-128526814 CCCACGCACATGTGCACAGGAGG + Intergenic
942418970 2:175787966-175787988 CTCACACACATGTACACACGCGG - Intergenic
944272944 2:197804366-197804388 CGCGCGCGCGTGTGCAAACCCGG - Intergenic
947744961 2:232502770-232502792 TGCACACACGTGTGCACACGGGG - Intergenic
1171184604 20:23116396-23116418 CTCACGTACATGTTCATACCAGG + Intergenic
1176103071 20:63373257-63373279 CTGTTGCCCGTGTGCACACCTGG - Intronic
1179628575 21:42662712-42662734 ATCACACACTTGTACACACCAGG + Intronic
1181508805 22:23379682-23379704 CTCACGAGCATGGGCACACCAGG - Intergenic
1183227061 22:36557722-36557744 TGCACGCACATGTGCACACATGG + Intergenic
1183263002 22:36808077-36808099 TGCAGGCACGTGTGCACACGGGG + Intronic
1184081691 22:42225851-42225873 CCCAGGCAAGTGTGCACACAGGG + Intronic
1184739656 22:46420481-46420503 CACTCACACGTGTGCACACGTGG + Intronic
1184821351 22:46911071-46911093 CACGTGCACATGTGCACACCTGG - Intronic
951717541 3:25664901-25664923 CACACACACATTTGCACACCGGG + Intronic
954710705 3:52503899-52503921 CCCAGGCACCTGTGCTCACCTGG - Exonic
957117216 3:76042328-76042350 CGCACATACCTGTGCACACCTGG - Intronic
960992395 3:123320475-123320497 CTTGTGCACGTGTGCACACATGG - Intronic
962350547 3:134652653-134652675 CACACGCGCGCGCGCACACCTGG + Intronic
969266002 4:6064500-6064522 CCCACGCATGTGTGCACACACGG - Intronic
973236683 4:47913936-47913958 CTCCCGCCCGCGTGCTCACCTGG - Intronic
979701152 4:123669309-123669331 CTCACACACACATGCACACCTGG - Intergenic
984584934 4:181552902-181552924 CACACGCACGTGTTTACACATGG - Intergenic
986737651 5:10680061-10680083 CCCAGGCAGCTGTGCACACCAGG + Exonic
1003131746 6:3400717-3400739 CACACGCACGTGTGTGCACTTGG + Intronic
1007097330 6:39221622-39221644 CTCTCGCCCTGGTGCACACCTGG + Intronic
1018165445 6:161090268-161090290 CTTACACACGAGTGCACACAAGG - Intronic
1019542205 7:1556454-1556476 CTCTCCCACGTGTCCCCACCAGG - Intronic
1019741935 7:2679386-2679408 CACACGCACGAGCGCACACGTGG - Intergenic
1027184991 7:75965782-75965804 CTCCAGCACGTGTTCACATCAGG - Intronic
1034313738 7:150111397-150111419 TACACACACGTGTGCACACAGGG - Intergenic
1034793161 7:153989399-153989421 TACACACACGTGTGCACACAGGG + Intronic
1035414757 7:158673571-158673593 CTTACACAGGTGTGCACCCCAGG + Intronic
1039901841 8:41758266-41758288 CTCAGGCTCCTGTGCACACCTGG - Intronic
1042124572 8:65525143-65525165 CTCAGGCACGTTTCCACATCAGG + Intergenic
1049339107 8:142102437-142102459 CCCATGCACCTGTGCACCCCCGG - Intergenic
1050867961 9:10528274-10528296 CTCATGCACGGATGCACAGCAGG - Intronic
1189438337 X:41012438-41012460 CTCTCGCACTTGTGGAGACCAGG + Intergenic