ID: 1113612731

View in Genome Browser
Species Human (GRCh38)
Location 13:111659047-111659069
Sequence CTGGCGCCCCTCAGTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113612731_1113612735 2 Left 1113612731 13:111659047-111659069 CCTTCATTACTGAGGGGCGCCAG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1113612735 13:111659072-111659094 ACCTAAAATAAATACTACCGGGG 0: 1
1: 0
2: 1
3: 11
4: 120
1113612731_1113612734 1 Left 1113612731 13:111659047-111659069 CCTTCATTACTGAGGGGCGCCAG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1113612734 13:111659071-111659093 GACCTAAAATAAATACTACCGGG 0: 1
1: 0
2: 4
3: 25
4: 422
1113612731_1113612733 0 Left 1113612731 13:111659047-111659069 CCTTCATTACTGAGGGGCGCCAG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1113612733 13:111659070-111659092 TGACCTAAAATAAATACTACCGG 0: 1
1: 0
2: 0
3: 30
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113612731 Original CRISPR CTGGCGCCCCTCAGTAATGA AGG (reversed) Intronic
900924361 1:5693980-5694002 AAGGCGTCCCTCAGCAATGAGGG + Intergenic
901824400 1:11851266-11851288 CTGGGGCCCCTGGGCAATGAAGG + Intergenic
903644577 1:24886830-24886852 CTGAGGCCCCTCAGCACTGATGG - Intergenic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
913484214 1:119318991-119319013 CTTGAGTCCCTAAGTAATGATGG + Intergenic
1063382971 10:5597638-5597660 CTGGGGTCCCTCAGTACTAAAGG - Intergenic
1069058244 10:63866849-63866871 CTGGGGCCTGGCAGTAATGATGG + Intergenic
1072248893 10:93566586-93566608 CTGGCGCTCCTCAGAAGGGAGGG + Intergenic
1078428634 11:11270566-11270588 CTGTGGTCCCTCAGGAATGAAGG + Intergenic
1080037209 11:27722200-27722222 CTGGAGACCCTTAGTCATGATGG - Intergenic
1081714762 11:45241887-45241909 CTGGCCAACCTCAGTGATGAAGG + Exonic
1089081612 11:115780931-115780953 CTGGGGCACCTCAGTTAAGATGG - Intergenic
1091879352 12:3964397-3964419 CTGGGGCGCTTCAGGAATGAAGG - Intergenic
1095711896 12:45298494-45298516 CTAGAGCCCCTCAGTAGTGGGGG + Intronic
1112283763 13:98085768-98085790 CTGGCCCCCCTCAGTATTATTGG + Intergenic
1113612731 13:111659047-111659069 CTGGCGCCCCTCAGTAATGAAGG - Intronic
1117067321 14:52023544-52023566 CTCAGGCCCCTGAGTAATGATGG + Intronic
1120229847 14:81829992-81830014 CTGTCACCTCTCAGTAATAATGG + Intergenic
1121331842 14:93054576-93054598 CTGGAGCCTCTCTGTAATCAAGG - Intronic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1124661348 15:31553278-31553300 CTGGGGCCCTACAGTATTGAGGG - Intronic
1131508111 15:93033756-93033778 CTGGAGGACCACAGTAATGAGGG - Intergenic
1131985724 15:98041565-98041587 CTGAAGCACCACAGTAATGAGGG - Intergenic
1140722610 16:77784930-77784952 CTGTCACCTCTCAGTACTGATGG + Intergenic
1148735549 17:49862822-49862844 CTTGGGCCCCTCTGTAATTAGGG + Intergenic
1153217419 18:2833726-2833748 CTTAGGCCCCTCAGGAATGAAGG - Intergenic
1162783110 19:13017449-13017471 CTGGCACCCCTCGGTCCTGAGGG - Intronic
1167570856 19:50288167-50288189 CAGGCCACCCTCACTAATGATGG + Intronic
925478137 2:4242060-4242082 ATGGTACCCCTCATTAATGATGG - Intergenic
927172023 2:20378512-20378534 AAGGCTCCCCTCAGGAATGAGGG - Intergenic
932749292 2:74361255-74361277 CTGAGGCCCCTCAGGAAGGAGGG + Exonic
942164845 2:173231861-173231883 CTGGTGCCCCTCAGCAATCCAGG + Intronic
944617840 2:201481299-201481321 CTGGACCCCCTCAAGAATGAAGG + Intergenic
948891816 2:240910528-240910550 CTCGAGCCCCTCAGCAAAGAGGG - Intergenic
1168765294 20:378166-378188 ATGGCCACCCTCAGTCATGACGG + Intronic
1169379861 20:5097006-5097028 CTGGAGCCTCTCTGCAATGAAGG + Intronic
1172971220 20:38874284-38874306 CAGGCACCCCTCAGGAATGTAGG - Intronic
1174628010 20:51931392-51931414 CTCTCGCCCCACAGTAAGGATGG - Intergenic
1181684064 22:24516341-24516363 CTGGGGCCCCTCATTTAGGAGGG + Intronic
952932880 3:38373828-38373850 CTGGGGCCCTTCAGCAATCAAGG + Intronic
953461138 3:43081974-43081996 CTGGGCCCACTCAGTCATGAGGG - Intronic
973820978 4:54661070-54661092 TTAGCGTCCCTCAGAAATGAAGG + Intronic
978829583 4:113067962-113067984 CCGGAGCCACTCAGTAATGCTGG + Intronic
981936929 4:150248950-150248972 CTGGAGCCTCCCAGAAATGACGG - Intronic
982868815 4:160550360-160550382 CCGCCGGCCCCCAGTAATGAGGG - Intergenic
985019127 4:185669110-185669132 CTGGAGCTCCTGAGGAATGAAGG + Intronic
988289815 5:29270657-29270679 CAAGCCTCCCTCAGTAATGATGG - Intergenic
994337661 5:98587371-98587393 ATGGAGTCTCTCAGTAATGACGG - Intergenic
1006261002 6:32870294-32870316 CTGTCCCCACTCAGTAATAATGG + Intergenic
1007321732 6:41032827-41032849 CGGGAGCCCCACAGGAATGAAGG - Intronic
1009886401 6:69628873-69628895 CTGCCTCCCAGCAGTAATGAGGG + Intergenic
1012491709 6:99789364-99789386 GTGGCACCCTTCAGAAATGATGG + Intergenic
1016858929 6:148698295-148698317 CTGCCGGCCCCCAGCAATGAGGG - Intergenic
1029552615 7:101245380-101245402 CTGACGCCCCTCAGAAATCTAGG + Intronic
1029603373 7:101583185-101583207 CTGGGGTCCCTCAGGGATGAGGG + Intergenic
1035999234 8:4582936-4582958 CTGCCGGCCCTGAGCAATGAGGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056724943 9:89106531-89106553 CTGCCTCCCCTCACTACTGAAGG - Intronic
1059149593 9:111937497-111937519 CTGGTGTCCGTCAGTCATGAGGG - Intergenic
1060500610 9:124151066-124151088 CTGGAGCTCCTCAGTATTCAAGG - Intergenic