ID: 1113616193

View in Genome Browser
Species Human (GRCh38)
Location 13:111682297-111682319
Sequence AAGATGTTCTAAAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113616190_1113616193 -8 Left 1113616190 13:111682282-111682304 CCTCTCTGCCTTAATAAGATGTT No data
Right 1113616193 13:111682297-111682319 AAGATGTTCTAAAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113616193 Original CRISPR AAGATGTTCTAAAGGAAAAA TGG Intergenic
No off target data available for this crispr