ID: 1113619168

View in Genome Browser
Species Human (GRCh38)
Location 13:111701339-111701361
Sequence GTCCCTGAGGACGGAAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113619150_1113619168 30 Left 1113619150 13:111701286-111701308 CCCACCAGCACAGGGGGCCAAGG No data
Right 1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG No data
1113619155_1113619168 26 Left 1113619155 13:111701290-111701312 CCAGCACAGGGGGCCAAGGGGAT No data
Right 1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG No data
1113619152_1113619168 29 Left 1113619152 13:111701287-111701309 CCACCAGCACAGGGGGCCAAGGG No data
Right 1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG No data
1113619157_1113619168 13 Left 1113619157 13:111701303-111701325 CCAAGGGGATGCTCTGTGGAGAG No data
Right 1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113619168 Original CRISPR GTCCCTGAGGACGGAAGGCA GGG Intergenic
No off target data available for this crispr