ID: 1113620996

View in Genome Browser
Species Human (GRCh38)
Location 13:111762777-111762799
Sequence GAGGGTTGCTAAGGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113620988_1113620996 17 Left 1113620988 13:111762737-111762759 CCTGCATCATCCTTGGTAGGAAG No data
Right 1113620996 13:111762777-111762799 GAGGGTTGCTAAGGGGCTGCTGG No data
1113620989_1113620996 7 Left 1113620989 13:111762747-111762769 CCTTGGTAGGAAGACGATGAAGG No data
Right 1113620996 13:111762777-111762799 GAGGGTTGCTAAGGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113620996 Original CRISPR GAGGGTTGCTAAGGGGCTGC TGG Intergenic
No off target data available for this crispr