ID: 1113621661

View in Genome Browser
Species Human (GRCh38)
Location 13:111767190-111767212
Sequence AAGATGTTCTAAAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113621658_1113621661 -8 Left 1113621658 13:111767175-111767197 CCTCTCTGCCTTAATAAGATGTT No data
Right 1113621661 13:111767190-111767212 AAGATGTTCTAAAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113621661 Original CRISPR AAGATGTTCTAAAGGAAAAA TGG Intergenic
No off target data available for this crispr