ID: 1113623047

View in Genome Browser
Species Human (GRCh38)
Location 13:111776671-111776693
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113623047_1113623052 12 Left 1113623047 13:111776671-111776693 CCGGCAAAGGCGGGACATTCCTG No data
Right 1113623052 13:111776706-111776728 GACATTACCACCTCTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113623047 Original CRISPR CAGGAATGTCCCGCCTTTGC CGG (reversed) Intergenic
No off target data available for this crispr