ID: 1113624697

View in Genome Browser
Species Human (GRCh38)
Location 13:111786600-111786622
Sequence GTCCCTGAGGACGGAAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113624681_1113624697 29 Left 1113624681 13:111786548-111786570 CCACCAGCACAGGGGGCCAAGGG No data
Right 1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG No data
1113624686_1113624697 13 Left 1113624686 13:111786564-111786586 CCAAGGGGATGCTCTGTGGAGAG No data
Right 1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG No data
1113624679_1113624697 30 Left 1113624679 13:111786547-111786569 CCCACCAGCACAGGGGGCCAAGG No data
Right 1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG No data
1113624684_1113624697 26 Left 1113624684 13:111786551-111786573 CCAGCACAGGGGGCCAAGGGGAT No data
Right 1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113624697 Original CRISPR GTCCCTGAGGACGGAAGGCA GGG Intergenic
No off target data available for this crispr