ID: 1113625919

View in Genome Browser
Species Human (GRCh38)
Location 13:111846289-111846311
Sequence GGCCCCAGGAAGGACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113625909_1113625919 3 Left 1113625909 13:111846263-111846285 CCTGGGGGCCTTCGGCCGGAAGG No data
Right 1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG No data
1113625913_1113625919 -5 Left 1113625913 13:111846271-111846293 CCTTCGGCCGGAAGGGCCGGCCC No data
Right 1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG No data
1113625908_1113625919 4 Left 1113625908 13:111846262-111846284 CCCTGGGGGCCTTCGGCCGGAAG No data
Right 1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113625919 Original CRISPR GGCCCCAGGAAGGACAGTGA GGG Intergenic
No off target data available for this crispr