ID: 1113626602

View in Genome Browser
Species Human (GRCh38)
Location 13:111852510-111852532
Sequence ATGGACTAGGGGACTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113626597_1113626602 -5 Left 1113626597 13:111852492-111852514 CCGGGAGATGCTAAACTCATGGA No data
Right 1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG No data
1113626592_1113626602 14 Left 1113626592 13:111852473-111852495 CCGGGTAACAGTGCCAAGTCCGG No data
Right 1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG No data
1113626595_1113626602 1 Left 1113626595 13:111852486-111852508 CCAAGTCCGGGAGATGCTAAACT No data
Right 1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113626602 Original CRISPR ATGGACTAGGGGACTGAGGA AGG Intergenic
No off target data available for this crispr