ID: 1113626732

View in Genome Browser
Species Human (GRCh38)
Location 13:111853305-111853327
Sequence TGGAATTGCCTGTGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113626732_1113626738 -1 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626738 13:111853327-111853349 AGGCGCGTCCTGGAGCGGGCTGG No data
1113626732_1113626739 0 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626739 13:111853328-111853350 GGCGCGTCCTGGAGCGGGCTGGG No data
1113626732_1113626736 -5 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626736 13:111853323-111853345 TTCCAGGCGCGTCCTGGAGCGGG No data
1113626732_1113626735 -6 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626735 13:111853322-111853344 ATTCCAGGCGCGTCCTGGAGCGG No data
1113626732_1113626743 8 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626743 13:111853336-111853358 CTGGAGCGGGCTGGGGCTGTGGG No data
1113626732_1113626742 7 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626742 13:111853335-111853357 CCTGGAGCGGGCTGGGGCTGTGG No data
1113626732_1113626740 1 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626740 13:111853329-111853351 GCGCGTCCTGGAGCGGGCTGGGG No data
1113626732_1113626745 21 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626745 13:111853349-111853371 GGGCTGTGGGCCTGATGTGTGGG No data
1113626732_1113626744 20 Left 1113626732 13:111853305-111853327 CCAGCAATTCACAGGCAATTCCA No data
Right 1113626744 13:111853348-111853370 GGGGCTGTGGGCCTGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113626732 Original CRISPR TGGAATTGCCTGTGAATTGC TGG (reversed) Intergenic
No off target data available for this crispr