ID: 1113629856

View in Genome Browser
Species Human (GRCh38)
Location 13:111874750-111874772
Sequence ACCAATGGACAATGGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113629856_1113629860 21 Left 1113629856 13:111874750-111874772 CCACCTGGCCATTGTCCATTGGT No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113629856 Original CRISPR ACCAATGGACAATGGCCAGG TGG (reversed) Intergenic
No off target data available for this crispr