ID: 1113629857

View in Genome Browser
Species Human (GRCh38)
Location 13:111874753-111874775
Sequence TATACCAATGGACAATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113629857_1113629860 18 Left 1113629857 13:111874753-111874775 CCTGGCCATTGTCCATTGGTATA No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113629857 Original CRISPR TATACCAATGGACAATGGCC AGG (reversed) Intergenic
No off target data available for this crispr