ID: 1113629858

View in Genome Browser
Species Human (GRCh38)
Location 13:111874758-111874780
Sequence CTAAATATACCAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113629858_1113629860 13 Left 1113629858 13:111874758-111874780 CCATTGTCCATTGGTATATTTAG No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113629858 Original CRISPR CTAAATATACCAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr