ID: 1113629859

View in Genome Browser
Species Human (GRCh38)
Location 13:111874765-111874787
Sequence TGAGAGACTAAATATACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113629859_1113629860 6 Left 1113629859 13:111874765-111874787 CCATTGGTATATTTAGTCTCTCA No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data
1113629859_1113629862 25 Left 1113629859 13:111874765-111874787 CCATTGGTATATTTAGTCTCTCA No data
Right 1113629862 13:111874813-111874835 AAGGTCTTTCCCAAAACTTTAGG No data
1113629859_1113629863 26 Left 1113629859 13:111874765-111874787 CCATTGGTATATTTAGTCTCTCA No data
Right 1113629863 13:111874814-111874836 AGGTCTTTCCCAAAACTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113629859 Original CRISPR TGAGAGACTAAATATACCAA TGG (reversed) Intergenic
No off target data available for this crispr