ID: 1113629860

View in Genome Browser
Species Human (GRCh38)
Location 13:111874794-111874816
Sequence AAATATAGACAATGAGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113629859_1113629860 6 Left 1113629859 13:111874765-111874787 CCATTGGTATATTTAGTCTCTCA No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data
1113629858_1113629860 13 Left 1113629858 13:111874758-111874780 CCATTGTCCATTGGTATATTTAG No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data
1113629857_1113629860 18 Left 1113629857 13:111874753-111874775 CCTGGCCATTGTCCATTGGTATA No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data
1113629856_1113629860 21 Left 1113629856 13:111874750-111874772 CCACCTGGCCATTGTCCATTGGT No data
Right 1113629860 13:111874794-111874816 AAATATAGACAATGAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113629860 Original CRISPR AAATATAGACAATGAGACCA AGG Intergenic
No off target data available for this crispr