ID: 1113632152

View in Genome Browser
Species Human (GRCh38)
Location 13:111895556-111895578
Sequence ATATGTATATGCTCTCATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113632152_1113632155 14 Left 1113632152 13:111895556-111895578 CCCGCATGAGAGCATATACATAT No data
Right 1113632155 13:111895593-111895615 ACATGTGTGTACACCCGCATGGG No data
1113632152_1113632154 13 Left 1113632152 13:111895556-111895578 CCCGCATGAGAGCATATACATAT No data
Right 1113632154 13:111895592-111895614 TACATGTGTGTACACCCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113632152 Original CRISPR ATATGTATATGCTCTCATGC GGG (reversed) Intergenic
No off target data available for this crispr