ID: 1113632153

View in Genome Browser
Species Human (GRCh38)
Location 13:111895557-111895579
Sequence CATATGTATATGCTCTCATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113632153_1113632154 12 Left 1113632153 13:111895557-111895579 CCGCATGAGAGCATATACATATG No data
Right 1113632154 13:111895592-111895614 TACATGTGTGTACACCCGCATGG No data
1113632153_1113632155 13 Left 1113632153 13:111895557-111895579 CCGCATGAGAGCATATACATATG No data
Right 1113632155 13:111895593-111895615 ACATGTGTGTACACCCGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113632153 Original CRISPR CATATGTATATGCTCTCATG CGG (reversed) Intergenic
No off target data available for this crispr