ID: 1113634331

View in Genome Browser
Species Human (GRCh38)
Location 13:111909586-111909608
Sequence ACTCGTTATCCTAGGACGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113634331_1113634343 30 Left 1113634331 13:111909586-111909608 CCGCACGTCCTAGGATAACGAGT No data
Right 1113634343 13:111909639-111909661 TATCCCGCCGTGAGTGGTGCTGG No data
1113634331_1113634338 -10 Left 1113634331 13:111909586-111909608 CCGCACGTCCTAGGATAACGAGT No data
Right 1113634338 13:111909599-111909621 GATAACGAGTGGACAGGGTGGGG No data
1113634331_1113634340 0 Left 1113634331 13:111909586-111909608 CCGCACGTCCTAGGATAACGAGT No data
Right 1113634340 13:111909609-111909631 GGACAGGGTGGGGTTGGTGAAGG No data
1113634331_1113634341 1 Left 1113634331 13:111909586-111909608 CCGCACGTCCTAGGATAACGAGT No data
Right 1113634341 13:111909610-111909632 GACAGGGTGGGGTTGGTGAAGGG No data
1113634331_1113634342 24 Left 1113634331 13:111909586-111909608 CCGCACGTCCTAGGATAACGAGT No data
Right 1113634342 13:111909633-111909655 AAGTCGTATCCCGCCGTGAGTGG No data
1113634331_1113634339 -6 Left 1113634331 13:111909586-111909608 CCGCACGTCCTAGGATAACGAGT No data
Right 1113634339 13:111909603-111909625 ACGAGTGGACAGGGTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113634331 Original CRISPR ACTCGTTATCCTAGGACGTG CGG (reversed) Intergenic
No off target data available for this crispr