ID: 1113634343

View in Genome Browser
Species Human (GRCh38)
Location 13:111909639-111909661
Sequence TATCCCGCCGTGAGTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113634331_1113634343 30 Left 1113634331 13:111909586-111909608 CCGCACGTCCTAGGATAACGAGT No data
Right 1113634343 13:111909639-111909661 TATCCCGCCGTGAGTGGTGCTGG No data
1113634334_1113634343 22 Left 1113634334 13:111909594-111909616 CCTAGGATAACGAGTGGACAGGG No data
Right 1113634343 13:111909639-111909661 TATCCCGCCGTGAGTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113634343 Original CRISPR TATCCCGCCGTGAGTGGTGC TGG Intergenic
No off target data available for this crispr