ID: 1113635181

View in Genome Browser
Species Human (GRCh38)
Location 13:111914532-111914554
Sequence GGAGATACTGGACCACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113635170_1113635181 19 Left 1113635170 13:111914490-111914512 CCCTGGTGCTCATCCCCTGAGGG No data
Right 1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG No data
1113635175_1113635181 4 Left 1113635175 13:111914505-111914527 CCTGAGGGCCTCTCTGTGTCCCA No data
Right 1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG No data
1113635172_1113635181 18 Left 1113635172 13:111914491-111914513 CCTGGTGCTCATCCCCTGAGGGC No data
Right 1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG No data
1113635177_1113635181 -4 Left 1113635177 13:111914513-111914535 CCTCTCTGTGTCCCACTGAGGAG No data
Right 1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG No data
1113635174_1113635181 5 Left 1113635174 13:111914504-111914526 CCCTGAGGGCCTCTCTGTGTCCC No data
Right 1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG No data
1113635168_1113635181 20 Left 1113635168 13:111914489-111914511 CCCCTGGTGCTCATCCCCTGAGG No data
Right 1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG No data
1113635173_1113635181 6 Left 1113635173 13:111914503-111914525 CCCCTGAGGGCCTCTCTGTGTCC No data
Right 1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113635181 Original CRISPR GGAGATACTGGACCACCCCC AGG Intergenic
No off target data available for this crispr