ID: 1113635601

View in Genome Browser
Species Human (GRCh38)
Location 13:111916983-111917005
Sequence GACCCAGGACAGTCTCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113635601_1113635610 21 Left 1113635601 13:111916983-111917005 CCACTTTGAGACTGTCCTGGGTC No data
Right 1113635610 13:111917027-111917049 GGGGCTCTTCTACCAAGTTCTGG No data
1113635601_1113635608 2 Left 1113635601 13:111916983-111917005 CCACTTTGAGACTGTCCTGGGTC No data
Right 1113635608 13:111917008-111917030 TTCCATCTTGAGGAACTGGGGGG No data
1113635601_1113635605 -1 Left 1113635601 13:111916983-111917005 CCACTTTGAGACTGTCCTGGGTC No data
Right 1113635605 13:111917005-111917027 CAATTCCATCTTGAGGAACTGGG No data
1113635601_1113635606 0 Left 1113635601 13:111916983-111917005 CCACTTTGAGACTGTCCTGGGTC No data
Right 1113635606 13:111917006-111917028 AATTCCATCTTGAGGAACTGGGG No data
1113635601_1113635604 -2 Left 1113635601 13:111916983-111917005 CCACTTTGAGACTGTCCTGGGTC No data
Right 1113635604 13:111917004-111917026 TCAATTCCATCTTGAGGAACTGG No data
1113635601_1113635607 1 Left 1113635601 13:111916983-111917005 CCACTTTGAGACTGTCCTGGGTC No data
Right 1113635607 13:111917007-111917029 ATTCCATCTTGAGGAACTGGGGG No data
1113635601_1113635603 -8 Left 1113635601 13:111916983-111917005 CCACTTTGAGACTGTCCTGGGTC No data
Right 1113635603 13:111916998-111917020 CCTGGGTCAATTCCATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113635601 Original CRISPR GACCCAGGACAGTCTCAAAG TGG (reversed) Intergenic
No off target data available for this crispr