ID: 1113636729

View in Genome Browser
Species Human (GRCh38)
Location 13:111924629-111924651
Sequence AACCTTTCGCTGCATGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113636729_1113636732 11 Left 1113636729 13:111924629-111924651 CCAAGCTCATGCAGCGAAAGGTT No data
Right 1113636732 13:111924663-111924685 CTTGGCTTCCCTTGACACCTTGG No data
1113636729_1113636731 -7 Left 1113636729 13:111924629-111924651 CCAAGCTCATGCAGCGAAAGGTT No data
Right 1113636731 13:111924645-111924667 AAAGGTTTCTCAGTGGCTCTTGG No data
1113636729_1113636735 23 Left 1113636729 13:111924629-111924651 CCAAGCTCATGCAGCGAAAGGTT No data
Right 1113636735 13:111924675-111924697 TGACACCTTGGTACTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113636729 Original CRISPR AACCTTTCGCTGCATGAGCT TGG (reversed) Intergenic
No off target data available for this crispr