ID: 1113639376

View in Genome Browser
Species Human (GRCh38)
Location 13:111946293-111946315
Sequence GCTCCATGTGCTCACCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113639376_1113639384 20 Left 1113639376 13:111946293-111946315 CCTGCAAGGTGAGCACATGGAGC No data
Right 1113639384 13:111946336-111946358 CACACACTGGGGTCAGCTTGCGG No data
1113639376_1113639377 7 Left 1113639376 13:111946293-111946315 CCTGCAAGGTGAGCACATGGAGC No data
Right 1113639377 13:111946323-111946345 TCCCTCCAGCCAACACACACTGG No data
1113639376_1113639385 24 Left 1113639376 13:111946293-111946315 CCTGCAAGGTGAGCACATGGAGC No data
Right 1113639385 13:111946340-111946362 CACTGGGGTCAGCTTGCGGCCGG No data
1113639376_1113639381 9 Left 1113639376 13:111946293-111946315 CCTGCAAGGTGAGCACATGGAGC No data
Right 1113639381 13:111946325-111946347 CCTCCAGCCAACACACACTGGGG No data
1113639376_1113639379 8 Left 1113639376 13:111946293-111946315 CCTGCAAGGTGAGCACATGGAGC No data
Right 1113639379 13:111946324-111946346 CCCTCCAGCCAACACACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113639376 Original CRISPR GCTCCATGTGCTCACCTTGC AGG (reversed) Intergenic
No off target data available for this crispr