ID: 1113640803

View in Genome Browser
Species Human (GRCh38)
Location 13:111955463-111955485
Sequence GGAGCCCACGGTCGCTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113640799_1113640803 -8 Left 1113640799 13:111955448-111955470 CCTGCTGGAGGGGAGGGAGCCCA No data
Right 1113640803 13:111955463-111955485 GGAGCCCACGGTCGCTGGGCAGG No data
1113640790_1113640803 4 Left 1113640790 13:111955436-111955458 CCCCCTGCGGTGCCTGCTGGAGG No data
Right 1113640803 13:111955463-111955485 GGAGCCCACGGTCGCTGGGCAGG No data
1113640789_1113640803 5 Left 1113640789 13:111955435-111955457 CCCCCCTGCGGTGCCTGCTGGAG No data
Right 1113640803 13:111955463-111955485 GGAGCCCACGGTCGCTGGGCAGG No data
1113640792_1113640803 3 Left 1113640792 13:111955437-111955459 CCCCTGCGGTGCCTGCTGGAGGG No data
Right 1113640803 13:111955463-111955485 GGAGCCCACGGTCGCTGGGCAGG No data
1113640796_1113640803 1 Left 1113640796 13:111955439-111955461 CCTGCGGTGCCTGCTGGAGGGGA No data
Right 1113640803 13:111955463-111955485 GGAGCCCACGGTCGCTGGGCAGG No data
1113640794_1113640803 2 Left 1113640794 13:111955438-111955460 CCCTGCGGTGCCTGCTGGAGGGG No data
Right 1113640803 13:111955463-111955485 GGAGCCCACGGTCGCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113640803 Original CRISPR GGAGCCCACGGTCGCTGGGC AGG Intergenic