ID: 1113643707

View in Genome Browser
Species Human (GRCh38)
Location 13:111976683-111976705
Sequence CACCCAGGCCGCGCCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113643707_1113643717 29 Left 1113643707 13:111976683-111976705 CCAACCAGGGCGCGGCCTGGGTG No data
Right 1113643717 13:111976735-111976757 AAATATGATGTTCCTCACCGAGG No data
1113643707_1113643715 -2 Left 1113643707 13:111976683-111976705 CCAACCAGGGCGCGGCCTGGGTG No data
Right 1113643715 13:111976704-111976726 TGGGTGGGTTTTAGGCTGTAAGG No data
1113643707_1113643716 -1 Left 1113643707 13:111976683-111976705 CCAACCAGGGCGCGGCCTGGGTG No data
Right 1113643716 13:111976705-111976727 GGGTGGGTTTTAGGCTGTAAGGG No data
1113643707_1113643713 -10 Left 1113643707 13:111976683-111976705 CCAACCAGGGCGCGGCCTGGGTG No data
Right 1113643713 13:111976696-111976718 GGCCTGGGTGGGTGGGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113643707 Original CRISPR CACCCAGGCCGCGCCCTGGT TGG (reversed) Intergenic
No off target data available for this crispr